Transcript: Mouse NM_001331051.1

Mus musculus hepatoma-derived growth factor (Hdgf), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Hdgf (15191)
Length:
2249
CDS:
387..1013

Additional Resources:

NCBI RefSeq record:
NM_001331051.1
NBCI Gene record:
Hdgf (15191)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001331051.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089223 CCCACTAAGAATACAGGGAAA pLKO.1 2041 3UTR 100% 4.050 5.670 N Hdgf n/a
2 TRCN0000332744 CCCACTAAGAATACAGGGAAA pLKO_005 2041 3UTR 100% 4.050 5.670 N Hdgf n/a
3 TRCN0000089224 CGAGAACAACCCTACAGTCAA pLKO.1 496 CDS 100% 4.950 3.960 N Hdgf n/a
4 TRCN0000363608 CGAGAACAACCCTACAGTCAA pLKO_005 496 CDS 100% 4.950 3.960 N Hdgf n/a
5 TRCN0000089226 GAAGGGAAACTGGTGATCGAT pLKO.1 705 CDS 100% 3.000 2.400 N Hdgf n/a
6 TRCN0000332828 GAAGGGAAACTGGTGATCGAT pLKO_005 705 CDS 100% 3.000 2.400 N Hdgf n/a
7 TRCN0000089225 GCCAACAAATACCAAGTCTTT pLKO.1 353 5UTR 100% 4.950 2.970 N Hdgf n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001331051.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06358 pDONR223 100% 61.8% 46.2% None (many diffs) n/a
2 ccsbBroad304_06358 pLX_304 0% 61.8% 46.2% V5 (many diffs) n/a
3 TRCN0000470424 ATTGACTAATAATCTATTTACCTC pLX_317 62% 61.8% 46.2% V5 (many diffs) n/a
Download CSV