Transcript: Human NM_001331089.1

Homo sapiens family with sequence similarity 122B (FAM122B), transcript variant 7, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
FAM122B (159090)
Length:
3536
CDS:
151..963

Additional Resources:

NCBI RefSeq record:
NM_001331089.1
NBCI Gene record:
FAM122B (159090)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001331089.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129012 GCATCCGATGTGTCCTTTATT pLKO.1 2674 3UTR 100% 15.000 21.000 N FAM122B n/a
2 TRCN0000420270 TGACAAGCCGGAGAAATTATA pLKO_005 510 CDS 100% 15.000 21.000 N FAM122B n/a
3 TRCN0000421039 TAACTGCTGTTTCCTACATAA pLKO_005 989 3UTR 100% 13.200 18.480 N FAM122B n/a
4 TRCN0000130108 CACTTAGAACTCGGAGGAATA pLKO.1 278 CDS 100% 10.800 15.120 N FAM122B n/a
5 TRCN0000128469 GCAGAGAACTTTGATCCATAA pLKO.1 1027 3UTR 100% 10.800 8.640 N FAM122B n/a
6 TRCN0000129792 CGGAGGAATAGTACAACAATT pLKO.1 289 CDS 100% 13.200 9.240 N FAM122B n/a
7 TRCN0000428785 AGAGTCCAGTCAAGTGCATTA pLKO_005 668 CDS 100% 10.800 7.560 N FAM122B n/a
8 TRCN0000427416 AGGCACTACCAATATGTTATC pLKO_005 762 CDS 100% 10.800 7.560 N FAM122B n/a
9 TRCN0000128707 CCAAGGCACTACCAATATGTT pLKO.1 759 CDS 100% 5.625 3.938 N FAM122B n/a
10 TRCN0000129537 CCAGTGTTCTTGGTCCTCTTA pLKO.1 692 CDS 100% 4.950 3.465 N FAM122B n/a
11 TRCN0000128808 CGCAGAGAACTTTGATCCATA pLKO.1 1026 3UTR 100% 4.950 3.465 N FAM122B n/a
12 TRCN0000130469 GCAGCAGTGATATGACAGATT pLKO.1 1317 3UTR 100% 4.950 3.465 N FAM122B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001331089.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05100 pDONR223 100% 91.4% 91.4% None 177_245del n/a
2 ccsbBroad304_05100 pLX_304 0% 91.4% 91.4% V5 177_245del n/a
3 TRCN0000480791 ACCAACCCCTCGTCAGTCAGCATA pLX_317 49.9% 91.4% 91.4% V5 177_245del n/a
Download CSV