Transcript: Human NM_001345923.1

Homo sapiens THADA armadillo repeat containing (THADA), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-02-25
Taxon:
Homo sapiens (human)
Gene:
THADA (63892)
Length:
6111
CDS:
141..5999

Additional Resources:

NCBI RefSeq record:
NM_001345923.1
NBCI Gene record:
THADA (63892)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001345923.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256943 TACGATTGGAATGGCATATTA pLKO_005 1474 CDS 100% 15.000 21.000 N THADA n/a
2 TRCN0000256940 TGTCTACCACTCCCGTGAAAT pLKO_005 4211 CDS 100% 13.200 18.480 N THADA n/a
3 TRCN0000256942 TTGATGGCATGTCTGCGAATA pLKO_005 1929 CDS 100% 10.800 15.120 N THADA n/a
4 TRCN0000061433 GCCTACTTAACTCAGCAAGTT pLKO.1 2739 CDS 100% 4.950 6.930 N THADA n/a
5 TRCN0000256936 AGAATCTTCTGATGGATTATT pLKO_005 3368 CDS 100% 15.000 10.500 N THADA n/a
6 TRCN0000256938 AGTGTCACAAATCCATTATAT pLKO_005 284 CDS 100% 15.000 10.500 N THADA n/a
7 TRCN0000256941 CACATCTGGATTAGCTATTAT pLKO_005 887 CDS 100% 15.000 10.500 N THADA n/a
8 TRCN0000061434 CCCAGGTTCATGCTTTAAATA pLKO.1 3754 CDS 100% 15.000 10.500 N THADA n/a
9 TRCN0000256937 TATTGGCAAGCTCACTAAATA pLKO_005 433 CDS 100% 15.000 10.500 N THADA n/a
10 TRCN0000256939 CAAGTAAGGATAGATACATTA pLKO_005 2046 CDS 100% 13.200 9.240 N THADA n/a
11 TRCN0000256944 GAATAAAGCAAGGCTTAATTC pLKO_005 2014 CDS 100% 13.200 9.240 N THADA n/a
12 TRCN0000256945 TTGATCTGGACGATGGATATT pLKO_005 5040 CDS 100% 13.200 9.240 N THADA n/a
13 TRCN0000061435 CCAGAATGCTTCTGCAAGATA pLKO.1 4938 CDS 100% 5.625 3.938 N THADA n/a
14 TRCN0000061436 CCCATCCTTAGGGTCTTGTAA pLKO.1 1886 CDS 100% 5.625 3.938 N THADA n/a
15 TRCN0000061437 GCTCTGAGACTTGCTTCCAAA pLKO.1 5094 CDS 100% 4.950 3.465 N THADA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001345923.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12432 pDONR223 100% 45.7% 45.6% None (many diffs) n/a
2 ccsbBroad304_12432 pLX_304 0% 45.7% 45.6% V5 (many diffs) n/a
3 TRCN0000467516 CAGGTCTCGCGGGTCGCGTGAAGG pLX_317 12.7% 45.7% 45.6% V5 (many diffs) n/a
4 ccsbBroadEn_12431 pDONR223 100% 34.5% 34.4% None 1_3834del;4150A>T n/a
5 ccsbBroad304_12431 pLX_304 0% 34.5% 34.4% V5 1_3834del;4150A>T n/a
6 TRCN0000480278 TTCCGAATGACTTGACCAAGACTC pLX_317 22% 34.5% 34.4% V5 1_3834del;4150A>T n/a
Download CSV