Transcript: Human NM_001345962.2

Homo sapiens abraxas 1, BRCA1 A complex subunit (ABRAXAS1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
ABRAXAS1 (84142)
Length:
4143
CDS:
289..1191

Additional Resources:

NCBI RefSeq record:
NM_001345962.2
NBCI Gene record:
ABRAXAS1 (84142)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001345962.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426063 ATCCTTAAAGGAGGTACATAA pLKO_005 582 CDS 100% 13.200 10.560 N ABRAXAS1 n/a
2 TRCN0000416367 TATTCACGGTCTCCTACATTT pLKO_005 1168 CDS 100% 13.200 9.240 N ABRAXAS1 n/a
3 TRCN0000122051 CCTTGTATGTAACTGGCATAA pLKO.1 2516 3UTR 100% 10.800 7.560 N ABRAXAS1 n/a
4 TRCN0000143855 CATCGACTGGAACATTCCTTA pLKO.1 400 CDS 100% 4.950 3.465 N ABRAXAS1 n/a
5 TRCN0000139032 CCAGTGGAACTCAGAACTGAT pLKO.1 1945 3UTR 100% 4.950 3.465 N ABRAXAS1 n/a
6 TRCN0000145012 GCAATCTGCTTAATGGACATT pLKO.1 2309 3UTR 100% 4.950 3.465 N ABRAXAS1 n/a
7 TRCN0000122344 CAGTACAAACACACAGCTCTA pLKO.1 542 CDS 100% 4.050 2.835 N ABRAXAS1 n/a
8 TRCN0000139964 GCATGTCTGAACAACTGGGTT pLKO.1 476 CDS 100% 2.640 1.848 N ABRAXAS1 n/a
9 TRCN0000143445 GCCTTAGACTTAGATGACAGA pLKO.1 1003 CDS 100% 2.640 1.848 N ABRAXAS1 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2996 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1485 3UTR 100% 4.950 2.475 Y ERN2 n/a
12 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1485 3UTR 100% 4.950 2.475 Y P3H4 n/a
13 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1485 3UTR 100% 4.950 2.475 Y P3H4 n/a
14 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1487 3UTR 100% 4.950 2.475 Y CFLAR n/a
15 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1487 3UTR 100% 4.950 2.475 Y C19orf31 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2996 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001345962.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12784 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12784 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478871 ATGGCTGCTTTCCGGAGTGTTTTA pLX_317 39.7% 100% 100% V5 n/a
Download CSV