Transcript: Human NM_001346113.2

Homo sapiens folliculin interacting protein 1 (FNIP1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
FNIP1 (96459)
Length:
1728
CDS:
97..1623

Additional Resources:

NCBI RefSeq record:
NM_001346113.2
NBCI Gene record:
FNIP1 (96459)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001346113.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239415 CGAATAGTTGATGCCCTAAAT pLKO_005 1270 CDS 100% 13.200 18.480 N FNIP1 n/a
2 TRCN0000047146 GCCAGATTCGACTGATTGTAT pLKO.1 215 CDS 100% 5.625 7.875 N RAPGEF6 n/a
3 TRCN0000130369 GCCAGATTCGACTGATTGTAT pLKO.1 215 CDS 100% 5.625 7.875 N FNIP1 n/a
4 TRCN0000128987 GAACCACCTTTGCTATCGTTT pLKO.1 1380 CDS 100% 4.950 6.930 N FNIP1 n/a
5 TRCN0000130238 CCAAATGGACAACCACCTATA pLKO.1 1510 CDS 100% 10.800 8.640 N FNIP1 n/a
6 TRCN0000239414 GGCAAAGACTCATCCATATAA pLKO_005 1575 CDS 100% 15.000 10.500 N FNIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346113.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13008 pDONR223 100% 99.9% 99.8% None 226G>T n/a
2 ccsbBroad304_13008 pLX_304 0% 99.9% 99.8% V5 226G>T n/a
3 TRCN0000474728 TGACCGGACACAAAGGTACTTTTC pLX_317 35.5% 99.9% 99.8% V5 226G>T n/a
Download CSV