Transcript: Human NM_001346114.2

Homo sapiens folliculin interacting protein 1 (FNIP1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
FNIP1 (96459)
Length:
6433
CDS:
97..3462

Additional Resources:

NCBI RefSeq record:
NM_001346114.2
NBCI Gene record:
FNIP1 (96459)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001346114.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239412 TGAGCTTATTCGACGAATATT pLKO_005 2456 CDS 100% 15.000 21.000 N FNIP1 n/a
2 TRCN0000239415 CGAATAGTTGATGCCCTAAAT pLKO_005 1135 CDS 100% 13.200 18.480 N FNIP1 n/a
3 TRCN0000047146 GCCAGATTCGACTGATTGTAT pLKO.1 215 CDS 100% 5.625 7.875 N RAPGEF6 n/a
4 TRCN0000130369 GCCAGATTCGACTGATTGTAT pLKO.1 215 CDS 100% 5.625 7.875 N FNIP1 n/a
5 TRCN0000128987 GAACCACCTTTGCTATCGTTT pLKO.1 1245 CDS 100% 4.950 6.930 N FNIP1 n/a
6 TRCN0000239413 CATGGTCCAGAGGCTACTTTA pLKO_005 1551 CDS 100% 13.200 10.560 N FNIP1 n/a
7 TRCN0000130238 CCAAATGGACAACCACCTATA pLKO.1 1375 CDS 100% 10.800 8.640 N FNIP1 n/a
8 TRCN0000239414 GGCAAAGACTCATCCATATAA pLKO_005 1440 CDS 100% 15.000 10.500 N FNIP1 n/a
9 TRCN0000239416 TTTACCTAGTCCCAGTTATTA pLKO_005 5052 3UTR 100% 15.000 10.500 N FNIP1 n/a
10 TRCN0000128278 GAATGGGACATTCCAAGAAAT pLKO.1 2749 CDS 100% 13.200 9.240 N FNIP1 n/a
11 TRCN0000131147 GCTGGGAAGGAAATGACCTAT pLKO.1 5730 3UTR 100% 4.950 3.465 N FNIP1 n/a
12 TRCN0000129563 GCATTGTCAGAGTCAGGCTTA pLKO.1 2038 CDS 100% 4.050 2.835 N FNIP1 n/a
13 TRCN0000128279 GCAGAAGCTGTCTGTATTATA pLKO.1 3094 CDS 100% 15.000 9.000 N FNIP1 n/a
14 TRCN0000164801 CCTCCCAAAGTACTGGGATTA pLKO.1 5514 3UTR 100% 1.080 0.540 Y MAPKAPK5-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346114.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13008 pDONR223 100% 39.7% 39.6% None 218_219ins135;1385_1391delGAGACTT;1397_3363del n/a
2 ccsbBroad304_13008 pLX_304 0% 39.7% 39.6% V5 218_219ins135;1385_1391delGAGACTT;1397_3363del n/a
3 TRCN0000474728 TGACCGGACACAAAGGTACTTTTC pLX_317 35.5% 39.7% 39.6% V5 218_219ins135;1385_1391delGAGACTT;1397_3363del n/a
Download CSV