Transcript: Human NM_001346115.2

Homo sapiens zinc finger and BTB domain containing 37 (ZBTB37), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-04-22
Taxon:
Homo sapiens (human)
Gene:
ZBTB37 (84614)
Length:
19231
CDS:
397..1323

Additional Resources:

NCBI RefSeq record:
NM_001346115.2
NBCI Gene record:
ZBTB37 (84614)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001346115.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418792 TCTGTTACACAGGGCGGATAT pLKO_005 653 CDS 100% 10.800 15.120 N ZBTB37 n/a
2 TRCN0000138252 CGGGATCACATGTCCTTGAAT pLKO.1 568 CDS 100% 5.625 7.875 N ZBTB37 n/a
3 TRCN0000138827 GCCCTCAGATCATTGAACCAA pLKO.1 980 CDS 100% 3.000 4.200 N ZBTB37 n/a
4 TRCN0000137273 CGGAGTGATGATGAAGTTAGA pLKO.1 1090 CDS 100% 4.950 3.960 N ZBTB37 n/a
5 TRCN0000423107 GATCCTGGAGGGCATTCATTT pLKO_005 756 CDS 100% 13.200 9.240 N ZBTB37 n/a
6 TRCN0000137342 GTTAGAGTTCTTGGAGCAGTA pLKO.1 1105 CDS 100% 4.050 2.835 N ZBTB37 n/a
7 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 13882 3UTR 100% 4.950 2.475 Y CFLAR n/a
8 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 13882 3UTR 100% 4.950 2.475 Y C19orf31 n/a
9 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 13880 3UTR 100% 4.950 2.475 Y ERN2 n/a
10 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 13880 3UTR 100% 4.950 2.475 Y P3H4 n/a
11 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 13880 3UTR 100% 4.950 2.475 Y P3H4 n/a
12 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 14049 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346115.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04403 pDONR223 100% 85.2% 85.3% None 924_924delGins160 n/a
2 ccsbBroad304_04403 pLX_304 0% 85.2% 85.3% V5 924_924delGins160 n/a
3 TRCN0000474611 GCAAAGCGCCCATACATGCATAAC pLX_317 46.9% 85.2% 85.3% V5 924_924delGins160 n/a
Download CSV