Transcript: Human NM_001346142.1

Homo sapiens aldo-keto reductase family 1 member B (AKR1B1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
AKR1B1 (231)
Length:
1402
CDS:
485..1003

Additional Resources:

NCBI RefSeq record:
NM_001346142.1
NBCI Gene record:
AKR1B1 (231)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001346142.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046412 CCATTGGATGAGTCGGGCAAT pLKO.1 422 5UTR 100% 4.050 5.670 N AKR1B1 n/a
2 TRCN0000288738 CCATTGGATGAGTCGGGCAAT pLKO_005 422 5UTR 100% 4.050 5.670 N AKR1B1 n/a
3 TRCN0000046411 TGCTGAGAACTTTAAGGTCTT pLKO.1 862 CDS 100% 4.050 3.240 N AKR1B1 n/a
4 TRCN0000288741 TGCTGAGAACTTTAAGGTCTT pLKO_005 862 CDS 100% 4.050 3.240 N AKR1B1 n/a
5 TRCN0000046408 CCAGGTGGAGATGATCTTAAA pLKO.1 547 CDS 100% 13.200 9.240 N AKR1B1 n/a
6 TRCN0000288812 CCAGGTGGAGATGATCTTAAA pLKO_005 547 CDS 100% 13.200 9.240 N AKR1B1 n/a
7 TRCN0000046410 TGTGCCCATGTGTACCAGAAT pLKO.1 185 5UTR 100% 4.950 3.465 N AKR1B1 n/a
8 TRCN0000046409 GTTCCCAGTGACACCAACATT pLKO.1 446 5UTR 100% 5.625 3.375 N AKR1B1 n/a
9 TRCN0000288740 GTTCCCAGTGACACCAACATT pLKO_005 446 5UTR 100% 5.625 3.375 N AKR1B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346142.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00055 pDONR223 100% 54.4% 54.4% None 0_1ins432 n/a
2 ccsbBroad304_00055 pLX_304 0% 54.4% 54.4% V5 0_1ins432 n/a
3 TRCN0000469510 GGTGGGCCTACCGTGCCCCGCTCA pLX_317 34.2% 54.4% 54.4% V5 0_1ins432 n/a
4 ccsbBroadEn_15354 pDONR223 0% 54.4% 54.4% None 0_1ins432 n/a
5 ccsbBroad304_15354 pLX_304 0% 54.4% 54.4% V5 0_1ins432 n/a
6 TRCN0000480316 TGGCCCATCAAACGAGCCTTATTT pLX_317 48.3% 54.4% 54.4% V5 0_1ins432 n/a
Download CSV