Transcript: Human NM_001346298.2

Homo sapiens microtubule associated monooxygenase, calponin and LIM domain containing 2 (MICAL2), transcript variant 14, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
MICAL2 (9645)
Length:
4791
CDS:
215..3526

Additional Resources:

NCBI RefSeq record:
NM_001346298.2
NBCI Gene record:
MICAL2 (9645)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001346298.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217310 GACTGCGATGAAGGCAAATTT pLKO.1 3281 CDS 100% 15.000 21.000 N Mical2 n/a
2 TRCN0000257045 GACTGCGATGAAGGCAAATTT pLKO_005 3281 CDS 100% 15.000 21.000 N MICAL2 n/a
3 TRCN0000046581 CGACACGTGTTACTTCTGTAA pLKO.1 3148 CDS 100% 4.950 6.930 N MICAL2 n/a
4 TRCN0000046580 GCTCGACAAAGGTGTCATCAT pLKO.1 1138 CDS 100% 4.950 6.930 N MICAL2 n/a
5 TRCN0000046582 GCTTGGCCAAATCATCCATTT pLKO.1 2142 CDS 100% 10.800 8.640 N MICAL2 n/a
6 TRCN0000233090 AGAGTCTCCCTCCCTTTATAG pLKO_005 4564 3UTR 100% 13.200 9.240 N MICAL2 n/a
7 TRCN0000233089 CAAGGACTGCACCCACTATTT pLKO_005 1090 CDS 100% 13.200 9.240 N MICAL2 n/a
8 TRCN0000233087 CCAAAGCCCTGTGGTACAAAT pLKO_005 399 CDS 100% 13.200 9.240 N MICAL2 n/a
9 TRCN0000046578 CCTCACTTCATTCACTGTAAA pLKO.1 3311 CDS 100% 13.200 9.240 N MICAL2 n/a
10 TRCN0000233088 TTGAGTTTGACGTCATCATTG pLKO_005 855 CDS 100% 10.800 7.560 N MICAL2 n/a
11 TRCN0000046579 CCCGGAGAACATCAACAAGAA pLKO.1 1570 CDS 100% 4.950 3.465 N MICAL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346298.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07456 pDONR223 100% 98% 98% None 409C>A;414T>G;2782_2783ins63 n/a
2 ccsbBroad304_07456 pLX_304 0% 98% 98% V5 409C>A;414T>G;2782_2783ins63 n/a
3 TRCN0000471327 GGAACCAGACAGATTGGCCTCCAG pLX_317 11.7% 98% 98% V5 409C>A;414T>G;2782_2783ins63 n/a
Download CSV