Transcript: Human NM_001346443.2

Homo sapiens cordon-bleu WH2 repeat protein (COBL), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
COBL (23242)
Length:
5037
CDS:
177..3698

Additional Resources:

NCBI RefSeq record:
NM_001346443.2
NBCI Gene record:
COBL (23242)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001346443.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005531 GCCTTATCTAACATCTCTAAA pLKO.1 2016 CDS 100% 13.200 10.560 N COBL n/a
2 TRCN0000335829 GCCTTATCTAACATCTCTAAA pLKO_005 2016 CDS 100% 13.200 10.560 N COBL n/a
3 TRCN0000335833 ATGATGAAGAAGACCTATTAA pLKO_005 1609 CDS 100% 15.000 10.500 N COBL n/a
4 TRCN0000335832 CACGGCCTCACAACGTATAAA pLKO_005 2283 CDS 100% 15.000 10.500 N COBL n/a
5 TRCN0000005533 CCATGCACTCACGTTCTCTTA pLKO.1 988 CDS 100% 4.950 3.465 N COBL n/a
6 TRCN0000005530 CCCAGTGTGTTCTCTACAGAT pLKO.1 3384 CDS 100% 4.950 3.465 N COBL n/a
7 TRCN0000335830 CCCAGTGTGTTCTCTACAGAT pLKO_005 3384 CDS 100% 4.950 3.465 N COBL n/a
8 TRCN0000005529 GCTGGATTCTTCTTCCTCAAA pLKO.1 4249 3UTR 100% 4.950 3.465 N COBL n/a
9 TRCN0000335915 GCTGGATTCTTCTTCCTCAAA pLKO_005 4249 3UTR 100% 4.950 3.465 N COBL n/a
10 TRCN0000005532 GCCTGAGAAATCTGTGCGTTT pLKO.1 626 CDS 100% 4.050 2.835 N COBL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346443.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07861 pDONR223 100% 92.8% 92.7% None (many diffs) n/a
2 ccsbBroad304_07861 pLX_304 0% 92.8% 92.7% V5 (many diffs) n/a
3 TRCN0000479311 TGCAAACCGATACCCTGAGTACCC pLX_317 4.7% 92.8% 92.7% V5 (many diffs) n/a
Download CSV