Transcript: Human NM_001346497.2

Homo sapiens TAO kinase 3 (TAOK3), transcript variant 12, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
TAOK3 (51347)
Length:
2041
CDS:
540..1805

Additional Resources:

NCBI RefSeq record:
NM_001346497.2
NBCI Gene record:
TAOK3 (51347)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001346497.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242196 AGCGCTTTGCCACGATCAAAT pLKO_005 457 5UTR 100% 13.200 18.480 N Taok3 n/a
2 TRCN0000273361 AGCGCTTTGCCACGATCAAAT pLKO_005 457 5UTR 100% 13.200 18.480 N TAOK3 n/a
3 TRCN0000001527 GAGTACAATAAGAGGCGAGAA pLKO.1 1221 CDS 100% 4.050 3.240 N TAOK3 n/a
4 TRCN0000382396 GAGCGGATCTCCAAACATAAA pLKO_005 897 CDS 100% 13.200 9.240 N TAOK3 n/a
5 TRCN0000001529 AGCGAGAGAATAAAGAACCTA pLKO.1 1731 CDS 100% 3.000 2.100 N TAOK3 n/a
6 TRCN0000273334 GGAACAGATGTCAGGTTATAA pLKO_005 533 5UTR 100% 15.000 9.000 N TAOK3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346497.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15065 pDONR223 0% 46.1% 45.3% None (many diffs) n/a
2 ccsbBroad304_15065 pLX_304 0% 46.1% 45.3% V5 (many diffs) n/a
3 TRCN0000465631 GATCACGGGGCAACCCTTCGATAC pLX_317 13.2% 46.1% 45.3% V5 (many diffs) n/a
4 TRCN0000487785 CCTCCAGGGTGACACTCCAAACGT pLX_317 10.6% 46.1% 45.3% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488252 CCATAATCCTTCGCATTACGCTCA pLX_317 13.1% 46.1% 45.3% V5 (many diffs) n/a
Download CSV