Transcript: Human NM_001346743.2

Homo sapiens chromobox 7 (CBX7), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
CBX7 (23492)
Length:
4108
CDS:
237..989

Additional Resources:

NCBI RefSeq record:
NM_001346743.2
NBCI Gene record:
CBX7 (23492)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001346743.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236360 TTTAGTTGTCCACGGTCAATT pLKO_005 2754 3UTR 100% 13.200 18.480 N CBX7 n/a
2 TRCN0000236357 GAAGGGTAAAGTCGAGTATCT pLKO_005 302 CDS 100% 4.950 6.930 N CBX7 n/a
3 TRCN0000236358 GGAAGTTCTGAATCACCGTTT pLKO_005 979 CDS 100% 4.050 5.670 N CBX7 n/a
4 TRCN0000019145 GTATAGGAAGAGAGGTCCGAA pLKO.1 440 CDS 100% 2.640 3.696 N CBX7 n/a
5 TRCN0000236359 ATAGGAAGAGAGGTCCGAAAC pLKO_005 442 CDS 100% 6.000 4.200 N CBX7 n/a
6 TRCN0000019144 CGGAAGGGTAAAGTCGAGTAT pLKO.1 300 CDS 100% 4.950 3.465 N CBX7 n/a
7 TRCN0000019148 CCTCAAGTGAGGTGACCGTGA pLKO.1 880 CDS 100% 0.720 0.504 N CBX7 n/a
8 TRCN0000019146 CGTGACCGACATCACCGCCAA pLKO.1 896 CDS 100% 0.000 0.000 N CBX7 n/a
9 TRCN0000019147 CGCCGTGGAGAGCATCCGGAA pLKO.1 269 CDS 100% 0.000 0.000 N CBX7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346743.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07890 pDONR223 100% 99.3% 98.8% None 230A>G;597_598insGCA;712G>C n/a
2 ccsbBroad304_07890 pLX_304 0% 99.3% 98.8% V5 230A>G;597_598insGCA;712G>C n/a
3 TRCN0000465729 AAACCAAGTACTCCTGGCATAGAG pLX_317 51.2% 99.3% 98.8% V5 230A>G;597_598insGCA;712G>C n/a
Download CSV