Transcript: Mouse NM_001347075.1

Mus musculus X-prolyl aminopeptidase 3, mitochondrial (Xpnpep3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Xpnpep3 (321003)
Length:
6058
CDS:
87..1607

Additional Resources:

NCBI RefSeq record:
NM_001347075.1
NBCI Gene record:
Xpnpep3 (321003)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347075.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031961 GCCTTTCTTTACGCGAAGTTT pLKO.1 924 CDS 100% 5.625 7.875 N Xpnpep3 n/a
2 TRCN0000031962 GAGACGAACATGGTTTGGTAT pLKO.1 678 CDS 100% 4.950 3.960 N Xpnpep3 n/a
3 TRCN0000031959 GCTCCGATAGATGAAGCCTTT pLKO.1 909 CDS 100% 4.050 3.240 N Xpnpep3 n/a
4 TRCN0000031960 GCCGGTAAAGAAGATTCCAAA pLKO.1 194 CDS 100% 4.950 3.465 N Xpnpep3 n/a
5 TRCN0000031963 GCATGTCATGTTTACAGCGAA pLKO.1 154 CDS 100% 2.640 1.848 N Xpnpep3 n/a
6 TRCN0000073928 GCATTCCAGTTAACACATTTA pLKO.1 1847 3UTR 100% 13.200 9.240 N XPNPEP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347075.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03908 pDONR223 100% 87.1% 90.5% None (many diffs) n/a
2 ccsbBroad304_03908 pLX_304 0% 87.1% 90.5% V5 (many diffs) n/a
3 TRCN0000478758 TAGCGCCAACACCGTCGGCAAATT pLX_317 23.4% 87.1% 90.5% V5 (many diffs) n/a
Download CSV