Transcript: Mouse NM_001347163.1

Mus musculus zinc finger, FYVE domain containing 9 (Zfyve9), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Zfyve9 (230597)
Length:
6232
CDS:
253..4446

Additional Resources:

NCBI RefSeq record:
NM_001347163.1
NBCI Gene record:
Zfyve9 (230597)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347163.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065350 GCAATCTATTAGTGTTCCTTT pLKO.1 1875 CDS 100% 4.950 6.930 N Zfyve9 n/a
2 TRCN0000065352 GCTCGGTTTACATTCACCAAA pLKO.1 2296 CDS 100% 4.950 6.930 N Zfyve9 n/a
3 TRCN0000065348 CCTGCAAACAATGGAAATAAT pLKO.1 1978 CDS 100% 15.000 10.500 N Zfyve9 n/a
4 TRCN0000065349 CCCATCTGATTTATCTTTGAA pLKO.1 1239 CDS 100% 5.625 3.938 N Zfyve9 n/a
5 TRCN0000057044 GCAGCCAAATTAACAATGAAT pLKO.1 2695 CDS 100% 5.625 3.938 N ZFYVE9 n/a
6 TRCN0000065351 CGGAGAAACAAATGGATGCTT pLKO.1 875 CDS 100% 3.000 2.100 N Zfyve9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347163.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02153 pDONR223 100% 87.3% 87.5% None (many diffs) n/a
2 ccsbBroad304_02153 pLX_304 0% 87.3% 87.5% V5 (many diffs) n/a
3 TRCN0000478273 AGACGTACTTTTCTTAATCCTTAG pLX_317 7.2% 87.3% 87.5% V5 (many diffs) n/a
Download CSV