Transcript: Human NM_001347254.1

Homo sapiens cytochrome P450 family 19 subfamily A member 1 (CYP19A1), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
CYP19A1 (1588)
Length:
4485
CDS:
206..1717

Additional Resources:

NCBI RefSeq record:
NM_001347254.1
NBCI Gene record:
CYP19A1 (1588)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001347254.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064314 CGAAAGTGCTATCGTGGTTAA pLKO.1 832 CDS 100% 10.800 15.120 N CYP19A1 n/a
2 TRCN0000064316 CGTTACACTTCTGAGACGATT pLKO.1 1558 CDS 100% 4.950 6.930 N CYP19A1 n/a
3 TRCN0000064317 CAATCATTACAGCTCTCGATT pLKO.1 532 CDS 100% 4.950 3.960 N CYP19A1 n/a
4 TRCN0000064313 CCTAATGTTGAAGAGGCAATA pLKO.1 1181 CDS 100% 10.800 7.560 N CYP19A1 n/a
5 TRCN0000064315 GCAACTACTACAACCGGGTAT pLKO.1 426 CDS 100% 4.050 2.835 N CYP19A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347254.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06078 pDONR223 100% 99.8% 99.8% None 240A>G;619C>T n/a
2 ccsbBroad304_06078 pLX_304 0% 99.8% 99.8% V5 240A>G;619C>T n/a
3 TRCN0000465802 TAGGGGTGAACGCGAGCCTTCACG pLX_317 25.4% 99.8% 99.8% V5 240A>G;619C>T n/a
4 ccsbBroadEn_10765 pDONR223 100% 43% 41.7% None (many diffs) n/a
5 ccsbBroad304_10765 pLX_304 0% 43% 41.7% V5 (many diffs) n/a
6 TRCN0000475346 TACTGACAAACGCCTATGCAGTTC pLX_317 72.7% 43% 41.7% V5 (many diffs) n/a
7 ccsbBroadEn_10766 pDONR223 100% 35.4% 34.1% None (many diffs) n/a
8 ccsbBroad304_10766 pLX_304 0% 35.4% 34.1% V5 (many diffs) n/a
9 TRCN0000479090 ACGAAGTGCCACACTGTCATTTGT pLX_317 64.1% 35.4% 34.1% V5 (many diffs) n/a
Download CSV