Transcript: Mouse NM_001347315.1

Mus musculus N-acetylglucosamine kinase (Nagk), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Nagk (56174)
Length:
1369
CDS:
167..1252

Additional Resources:

NCBI RefSeq record:
NM_001347315.1
NBCI Gene record:
Nagk (56174)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347315.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025950 GCAGGCCATGTTCGACTATTT pLKO.1 775 CDS 100% 13.200 18.480 N Nagk n/a
2 TRCN0000322174 GCAGGCCATGTTCGACTATTT pLKO_005 775 CDS 100% 13.200 18.480 N Nagk n/a
3 TRCN0000025921 GCTTGGAATCCTCACCCATTT pLKO.1 811 CDS 100% 10.800 15.120 N Nagk n/a
4 TRCN0000025899 GTTGCGGCATTCTTCTGCATT pLKO.1 1138 CDS 100% 4.950 3.960 N Nagk n/a
5 TRCN0000322239 GTTGCGGCATTCTTCTGCATT pLKO_005 1138 CDS 100% 4.950 3.960 N Nagk n/a
6 TRCN0000322241 GTATAGGGACTTTGATAAATG pLKO_005 832 CDS 100% 13.200 9.240 N Nagk n/a
7 TRCN0000353114 ACTTTGATAAATGCAAGTTTG pLKO_005 840 CDS 100% 10.800 7.560 N Nagk n/a
8 TRCN0000322240 AGGCTCCAACTGTAGGCTTAT pLKO_005 601 CDS 100% 10.800 7.560 N Nagk n/a
9 TRCN0000199925 GCAGATGGACTGAGCACAAAC pLKO.1 308 CDS 100% 10.800 7.560 N NAGK n/a
10 TRCN0000025927 GCAGACATGTTGTGGCAGTAT pLKO.1 948 CDS 100% 4.950 3.465 N Nagk n/a
11 TRCN0000025879 GCTTTCCCAACCTGAGTGAAA pLKO.1 501 CDS 100% 4.950 3.465 N Nagk n/a
12 TRCN0000350679 GCTTTCCCAACCTGAGTGAAA pLKO_005 501 CDS 100% 4.950 3.465 N Nagk n/a
13 TRCN0000345198 ACATCAGGGAGACCCTCTTTC pLKO_005 892 CDS 100% 10.800 6.480 N Nagk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347315.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12226 pDONR223 100% 82.2% 84.8% None (many diffs) n/a
2 ccsbBroad304_12226 pLX_304 0% 82.2% 84.8% V5 (many diffs) n/a
3 TRCN0000475336 ACGTACCCTCCGTCTCCCGTATAC pLX_317 44.4% 82.2% 84.8% V5 (many diffs) n/a
4 ccsbBroadEn_15103 pDONR223 0% 82.2% 84.8% None (many diffs) n/a
5 ccsbBroad304_15103 pLX_304 0% 82.2% 84.8% V5 (many diffs) n/a
6 TRCN0000479754 TATCTCCTATGTTGTTCGCTGGGA pLX_317 35.3% 82.1% 84.5% V5 (many diffs) n/a
7 TRCN0000489125 GTATTTGGCCCGATCACCTCAACA pLX_317 32.4% 82.2% 84.8% V5 (not translated due to prior stop codon) (many diffs) n/a
8 ccsbBroadEn_15902 pDONR223 0% 82.1% 84.2% None (many diffs) n/a
9 ccsbBroad304_15902 pLX_304 0% 82.1% 84.2% V5 (many diffs) n/a
10 TRCN0000468607 TGTGGATTCCGACAATTGGGTTCG pLX_317 39.9% 82% 84.2% V5 (many diffs) n/a
Download CSV