Transcript: Mouse NM_001347351.1

Mus musculus ATPase, H+ transporting, lysosomal V1 subunit G2 (Atp6v1g2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Atp6v1g2 (66237)
Length:
1584
CDS:
362..595

Additional Resources:

NCBI RefSeq record:
NM_001347351.1
NBCI Gene record:
Atp6v1g2 (66237)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347351.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101503 CAACTATCGGGTTACTGTCTA pLKO.1 574 CDS 100% 4.950 6.930 N Atp6v1g2 n/a
2 TRCN0000101501 CTCAAATGGAGGTGGAGCAAT pLKO.1 357 5UTR 100% 4.950 3.465 N Atp6v1g2 n/a
3 TRCN0000101504 CTTCTCGGCATGGTCTGTGAA pLKO.1 533 CDS 100% 4.950 3.465 N Atp6v1g2 n/a
4 TRCN0000101500 GCTGTGAATTATCTGTGAGAA pLKO.1 1101 3UTR 100% 4.950 3.465 N Atp6v1g2 n/a
5 TRCN0000101502 GCAGGCCACAAGACGGCAGGT pLKO.1 460 CDS 100% 0.000 0.000 N Atp6v1g2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347351.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00139 pDONR223 100% 58.1% 61% None (many diffs) n/a
2 ccsbBroad304_00139 pLX_304 0% 58.1% 61% V5 (many diffs) n/a
3 TRCN0000470033 TTCTCGCCAATTACAGACCAGTTT pLX_317 100% 58.1% 61% V5 (many diffs) n/a
Download CSV