Transcript: Mouse NM_001348062.1

Mus musculus guanine nucleotide binding protein (G protein), beta 4 (Gnb4), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-04-15
Taxon:
Mus musculus (mouse)
Gene:
Gnb4 (14696)
Length:
5957
CDS:
129..1151

Additional Resources:

NCBI RefSeq record:
NM_001348062.1
NBCI Gene record:
Gnb4 (14696)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001348062.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377066 CAACCCTCTACCTTCTATTTG pLKO_005 1229 3UTR 100% 13.200 18.480 N Gnb4 n/a
2 TRCN0000109331 GCCGAATACAAATGCGAACAA pLKO.1 250 CDS 100% 4.950 6.930 N Gnb4 n/a
3 TRCN0000334625 GCCGAATACAAATGCGAACAA pLKO_005 250 CDS 100% 4.950 6.930 N Gnb4 n/a
4 TRCN0000109334 CGACAAATAAGATGCACGCCA pLKO.1 385 CDS 100% 0.660 0.924 N Gnb4 n/a
5 TRCN0000348344 GGGATAGCTATACGACAAATA pLKO_005 373 CDS 100% 13.200 10.560 N Gnb4 n/a
6 TRCN0000377065 TGCTATACTCTCATGACAATA pLKO_005 913 CDS 100% 13.200 9.240 N Gnb4 n/a
7 TRCN0000377067 TGGTCATGACAACCGTGTTAG pLKO_005 1055 CDS 100% 10.800 7.560 N Gnb4 n/a
8 TRCN0000109330 GCGTTCAATAAGCTGTAGTTT pLKO.1 1292 3UTR 100% 5.625 3.938 N Gnb4 n/a
9 TRCN0000109333 GCTGGTTCAGATCACGTCTAA pLKO.1 215 CDS 100% 4.950 3.465 N Gnb4 n/a
10 TRCN0000334698 GCTGGTTCAGATCACGTCTAA pLKO_005 215 CDS 100% 4.950 3.465 N Gnb4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348062.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08785 pDONR223 100% 85.1% 96.4% None (many diffs) n/a
2 ccsbBroad304_08785 pLX_304 0% 85.1% 96.4% V5 (many diffs) n/a
3 TRCN0000470309 TTAATCACTAATCACTGTATTAGT pLX_317 39.7% 85.1% 96.4% V5 (many diffs) n/a
Download CSV