Construct: ORF TRCN0000470309
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003452.1_s317c1
- Derived from:
- ccsbBroadEn_08785
- DNA Barcode:
- TTAATCACTAATCACTGTATTAGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GNB4 (59345)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470309
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 59345 | GNB4 | G protein subunit beta 4 | NM_021629.4 | 99.8% | 99.7% | 11T>C;117T>C |
| 2 | human | 59345 | GNB4 | G protein subunit beta 4 | XM_005247692.2 | 99.8% | 99.7% | 11T>C;117T>C |
| 3 | human | 59345 | GNB4 | G protein subunit beta 4 | XM_006713721.2 | 99.8% | 99.7% | 11T>C;117T>C |
| 4 | human | 2782 | GNB1 | G protein subunit beta 1 | NM_002074.5 | 75.8% | 90.5% | (many diffs) |
| 5 | human | 2782 | GNB1 | G protein subunit beta 1 | XM_017001059.2 | 75.8% | 90.5% | (many diffs) |
| 6 | human | 2782 | GNB1 | G protein subunit beta 1 | XM_017001060.2 | 75.8% | 90.5% | (many diffs) |
| 7 | human | 2782 | GNB1 | G protein subunit beta 1 | XM_017001061.2 | 75.8% | 90.5% | (many diffs) |
| 8 | human | 2782 | GNB1 | G protein subunit beta 1 | XM_024446495.1 | 75.8% | 90.5% | (many diffs) |
| 9 | mouse | 14696 | Gnb4 | guanine nucleotide binding ... | NM_001348062.1 | 85.1% | 96.4% | (many diffs) |
| 10 | mouse | 14696 | Gnb4 | guanine nucleotide binding ... | NM_001348104.1 | 85.1% | 96.4% | (many diffs) |
| 11 | mouse | 14696 | Gnb4 | guanine nucleotide binding ... | NM_013531.5 | 85.1% | 96.4% | (many diffs) |
| 12 | mouse | 14696 | Gnb4 | guanine nucleotide binding ... | XM_006535403.3 | 85.1% | 96.4% | (many diffs) |
| 13 | mouse | 14688 | Gnb1 | guanine nucleotide binding ... | XM_017319977.2 | 77.1% | 90.5% | (many diffs) |
| 14 | mouse | 14696 | Gnb4 | guanine nucleotide binding ... | NM_001348105.1 | 76.3% | 86.1% | (many diffs) |
| 15 | mouse | 14696 | Gnb4 | guanine nucleotide binding ... | XM_006535404.3 | 62.2% | 70.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1086
- ORF length:
- 1020
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag cgaaccggaa cagttgaggc aagaagcaga acaactgcgg aatcagattc 121 aggatgctcg gaaagcatgt aatgatgcaa cgcttgttca gattacatca aatatggact 181 ccgtgggtcg aatacaaatg cgaacaagac gtacactgag gggccaccta gctaaaatct 241 atgctatgca ttggggatac gattccaggc tgctagtcag tgcttctcaa gatggaaaat 301 taattatttg ggatagctat acaacaaata agatgcatgc tattcctttg aggtcctcct 361 gggtgatgac ctgtgcttat gctccctctg gtaattatgt tgcctgtgga ggcttggaca 421 acatctgctc tatatataac ttaaagacca gagagggaaa tgtgagagta agccgagagt 481 tgccaggtca cacagggtac ttgtcctgct gtcgtttttt agatgacagc caaattgtta 541 caagttcagg agatacaact tgtgctttat gggacatcga aactgcccag cagaccacca 601 cattcactgg gcattctgga gatgtgatga gtctttcttt gagtcctgac atgaggactt 661 ttgtttctgg tgcttgtgat gccTCTTCCA AATTATGGGA TATTCGAGAT GGAATGTGTA 721 GACAGTCTTT CACGGGACAT GTCTCAGATA TCAATGCTGT CAGTTTTTTC CCAAATGGAT 781 ATGCCTTCGC CACTGGCTCT GATGATGCCA CTTGCCGGCT CTTTGACCTT CGTGCAGATC 841 AAGAGTTATT ATTGTATTCT CATGACAATA TCATCTGTGG AATCACTTCT GTAGCCTTCT 901 CAAAAAGTGG GCGTCTCTTG TTGGCTGGTT ACGATGACTT TAATTGTAAT GTATGGGACA 961 CGCTAAAAGG AGATCGTGCA GGTGTCCTTG CTGGTCATGA CAACCGTGTG AGCTGCTTAG 1021 GTGTAACTGA TGATGGCATG GCTGTGGCAA CAGGCTCTTG GGACAGTTTT CTTAGAATCT 1081 GGAATTACCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1141 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1201 CTTGGCTTTA TATATCTTGT GGAAAGGACG ATTAATCACT AATCACTGTA TTAGTACGCG 1261 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt