Transcript: Human NM_001348092.2

Homo sapiens F-box protein 30 (FBXO30), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
FBXO30 (84085)
Length:
8962
CDS:
121..2358

Additional Resources:

NCBI RefSeq record:
NM_001348092.2
NBCI Gene record:
FBXO30 (84085)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348092.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128825 GCAGCGTTCAATGTTTACCTT pLKO.1 1662 CDS 100% 3.000 4.200 N FBXO30 n/a
2 TRCN0000129041 GCCCTTTAGCTTACTATGGTT pLKO.1 1784 CDS 100% 3.000 4.200 N FBXO30 n/a
3 TRCN0000251379 ACCTATTCTCAGCGTAGATTT pLKO_005 1807 CDS 100% 13.200 9.240 N Fbxo30 n/a
4 TRCN0000435407 TCTCATGTGTATCCAAGTTAA pLKO_005 2027 CDS 100% 13.200 9.240 N FBXO30 n/a
5 TRCN0000430505 GTCGATGAAGTGGCACAATTG pLKO_005 460 CDS 100% 10.800 7.560 N FBXO30 n/a
6 TRCN0000130458 GCCCGAAATAAAGTTGCTGAA pLKO.1 334 CDS 100% 4.050 2.835 N FBXO30 n/a
7 TRCN0000130382 GTGCTGTACTATGGAATGGAA pLKO.1 384 CDS 100% 3.000 2.100 N FBXO30 n/a
8 TRCN0000128826 GTACCTATTCTCAGCGTAGAT pLKO.1 1805 CDS 100% 0.000 0.000 N FBXO30 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348092.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12775 pDONR223 100% 90.6% 90.6% None 1_210del n/a
2 ccsbBroad304_12775 pLX_304 0% 90.6% 90.6% V5 1_210del n/a
3 TRCN0000477906 TTGCTACCTCCATTACGACAATTG pLX_317 18.9% 90.6% 90.6% V5 1_210del n/a
Download CSV