Transcript: Human NM_001348142.1

Homo sapiens protein phosphatase 4 regulatory subunit 4 (PPP4R4), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
PPP4R4 (57718)
Length:
3864
CDS:
394..2772

Additional Resources:

NCBI RefSeq record:
NM_001348142.1
NBCI Gene record:
PPP4R4 (57718)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348142.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215543 GATGACAGAAGTCAAACTATA pLKO.1 1003 CDS 100% 13.200 9.240 N Ppp4r4 n/a
2 TRCN0000454980 GGAACAAGTGTGATTGCAAAT pLKO_005 361 5UTR 100% 10.800 7.560 N PPP4R4 n/a
3 TRCN0000437656 TGAGACGCTTCGGAGAGTGTT pLKO_005 411 CDS 100% 4.950 3.465 N PPP4R4 n/a
4 TRCN0000167550 GATGAAGACCTCAGTGATATT pLKO.1 298 5UTR 100% 13.200 7.920 N PPP4R4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348142.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03846 pDONR223 100% 90.7% 90.7% None 0_1ins243 n/a
2 ccsbBroad304_03846 pLX_304 0% 90.7% 90.7% V5 0_1ins243 n/a
3 TRCN0000480615 CAACTTTTTCAAAAGAATTGGTGC pLX_317 17.5% 90.7% 90.7% V5 0_1ins243 n/a
Download CSV