Transcript: Human NM_001348534.2

Homo sapiens lysine rich nucleolar protein 1 (KNOP1), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
KNOP1 (400506)
Length:
6353
CDS:
73..1380

Additional Resources:

NCBI RefSeq record:
NM_001348534.2
NBCI Gene record:
KNOP1 (400506)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348534.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264084 CAGTCAAGCTGGAAGATTAAA pLKO_005 1361 CDS 100% 15.000 10.500 N KNOP1 n/a
2 TRCN0000264086 ACTGAAATTTCTCAGACTTAT pLKO_005 1122 CDS 100% 13.200 9.240 N KNOP1 n/a
3 TRCN0000264085 TGCTGATGTTTCTCCTTTAAG pLKO_005 186 CDS 100% 13.200 9.240 N KNOP1 n/a
4 TRCN0000264087 CCCATAAGTGATGACCCTAAG pLKO_005 841 CDS 100% 6.000 4.200 N KNOP1 n/a
5 TRCN0000264088 ACTAGGCATAAATGGTTTATT pLKO_005 1542 3UTR 100% 15.000 9.000 N KNOP1 n/a
6 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3925 3UTR 100% 4.950 2.475 Y ERAP2 n/a
7 TRCN0000168774 GAGATGGAGTTTCACCATGTT pLKO.1 5466 3UTR 100% 4.950 2.475 Y LOC400464 n/a
8 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 3991 3UTR 100% 13.200 6.600 Y IQCC n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3926 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348534.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05632 pDONR223 100% 94.9% 94.9% None 916_917ins69 n/a
2 ccsbBroad304_05632 pLX_304 0% 94.9% 94.9% V5 916_917ins69 n/a
3 TRCN0000477198 TTTGACCGCTGGCTTCAAATACAC pLX_317 32.3% 94.9% 94.9% V5 916_917ins69 n/a
Download CSV