Transcript: Human NM_001350151.2

Homo sapiens filamin binding LIM protein 1 (FBLIM1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
FBLIM1 (54751)
Length:
3514
CDS:
465..1586

Additional Resources:

NCBI RefSeq record:
NM_001350151.2
NBCI Gene record:
FBLIM1 (54751)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350151.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149253 GAACAACCATCTCTTCTGCAA pLKO.1 1526 CDS 100% 2.640 3.696 N FBLIM1 n/a
2 TRCN0000319270 GAACAACCATCTCTTCTGCAA pLKO_005 1526 CDS 100% 2.640 3.696 N FBLIM1 n/a
3 TRCN0000148836 CTCACTCATTGCAGACTTAGA pLKO.1 845 CDS 100% 4.950 3.465 N FBLIM1 n/a
4 TRCN0000319336 CTCACTCATTGCAGACTTAGA pLKO_005 845 CDS 100% 4.950 3.465 N FBLIM1 n/a
5 TRCN0000149805 GCACGGACAAGTTAAACAGAA pLKO.1 3147 3UTR 100% 4.950 3.465 N FBLIM1 n/a
6 TRCN0000319339 GCACGGACAAGTTAAACAGAA pLKO_005 3147 3UTR 100% 4.950 3.465 N FBLIM1 n/a
7 TRCN0000146787 CCTTTGAAGGAGAATCATCAT pLKO.1 3093 3UTR 100% 4.950 2.970 N FBLIM1 n/a
8 TRCN0000319338 CCTTTGAAGGAGAATCATCAT pLKO_005 3093 3UTR 100% 4.950 2.970 N FBLIM1 n/a
9 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 2074 3UTR 100% 4.950 2.475 Y ORAI2 n/a
10 TRCN0000127601 CGCTTGTAATCCCAGCACTTT pLKO.1 1996 3UTR 100% 4.950 2.475 Y CCDC30 n/a
11 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 2336 3UTR 100% 4.050 2.025 Y P3H4 n/a
12 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 2336 3UTR 100% 4.050 2.025 Y ORAI2 n/a
13 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 2336 3UTR 100% 4.050 2.025 Y P3H4 n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2298 3UTR 100% 13.200 6.600 Y LIAS n/a
15 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 2071 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350151.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08407 pDONR223 100% 99.9% 99.7% None 572C>T n/a
2 ccsbBroad304_08407 pLX_304 0% 99.9% 99.7% V5 572C>T n/a
3 TRCN0000475123 AGCGCATTTCAGTTTACTGAGTAC pLX_317 41.2% 99.9% 99.7% V5 572C>T n/a
Download CSV