Transcript: Human NM_001350622.1

Homo sapiens KH RNA binding domain containing, signal transduction associated 2 (KHDRBS2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
KHDRBS2 (202559)
Length:
2383
CDS:
280..1380

Additional Resources:

NCBI RefSeq record:
NM_001350622.1
NBCI Gene record:
KHDRBS2 (202559)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350622.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429734 TGTACTGTTGGCGTGACATTG pLKO_005 1541 3UTR 100% 10.800 8.640 N KHDRBS2 n/a
2 TRCN0000427029 TTAGCAAGCATAGTCTATAAA pLKO_005 1600 3UTR 100% 15.000 10.500 N KHDRBS2 n/a
3 TRCN0000418509 GAGTGATGAGCTTCATGTATT pLKO_005 660 CDS 100% 13.200 9.240 N KHDRBS2 n/a
4 TRCN0000422583 AGCTAAGGAAGAAGAACTAAG pLKO_005 609 CDS 100% 10.800 7.560 N KHDRBS2 n/a
5 TRCN0000016895 CAGACCTATGAGACTTATGAT pLKO.1 1177 CDS 100% 5.625 3.938 N KHDRBS2 n/a
6 TRCN0000016894 CCAGCCCATGAAGCTTATGAA pLKO.1 1063 CDS 100% 5.625 3.938 N KHDRBS2 n/a
7 TRCN0000016896 GCTCTCAGAAAGAGTACTGAT pLKO.1 456 CDS 100% 4.950 3.465 N KHDRBS2 n/a
8 TRCN0000016897 CGTCAGGAACAACTACGTGAA pLKO.1 781 CDS 100% 4.050 2.835 N KHDRBS2 n/a
9 TRCN0000016893 CCTGACTACAATGATGAAATT pLKO.1 760 CDS 100% 13.200 7.920 N KHDRBS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350622.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09825 pDONR223 100% 95.1% 95% None 811_861del;927T>C;1027C>A n/a
2 ccsbBroad304_09825 pLX_304 0% 95.1% 95% V5 811_861del;927T>C;1027C>A n/a
3 TRCN0000468185 TTTTAGCTTTGTCAGTAAAATCGA pLX_317 39.6% 95.1% 95% V5 811_861del;927T>C;1027C>A n/a
Download CSV