Transcript: Human NM_001350653.1

Homo sapiens centrosomal protein 57 like 1 (CEP57L1), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
CEP57L1 (285753)
Length:
6940
CDS:
1402..2784

Additional Resources:

NCBI RefSeq record:
NM_001350653.1
NBCI Gene record:
CEP57L1 (285753)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350653.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425654 GAACATCAGCGTAAGCTATTT pLKO_005 2020 CDS 100% 13.200 18.480 N CEP57L1 n/a
2 TRCN0000150697 GCTGAGGACAAGATTAAACAT pLKO.1 1975 CDS 100% 5.625 7.875 N CEP57L1 n/a
3 TRCN0000418640 TAGTAGGTTTGGAACCTTAAA pLKO_005 3137 3UTR 100% 13.200 10.560 N CEP57L1 n/a
4 TRCN0000152263 CTAAGATACTTCATAGCCCAA pLKO.1 1532 CDS 100% 2.160 1.728 N CEP57L1 n/a
5 TRCN0000155059 GCAGAAGCTTTCCTCTGCTAT pLKO.1 3368 3UTR 100% 0.495 0.396 N CEP57L1 n/a
6 TRCN0000427845 GACGACCACCTTGGCAAATTT pLKO_005 2165 CDS 100% 15.000 10.500 N CEP57L1 n/a
7 TRCN0000151002 CATCAAGACAGTGTCTGTAAA pLKO.1 2551 CDS 100% 13.200 9.240 N CEP57L1 n/a
8 TRCN0000432742 ATTCAGTCTGTGACGACATAG pLKO_005 2462 CDS 100% 10.800 7.560 N CEP57L1 n/a
9 TRCN0000151881 CCTCTCCTAAGATACTTCATA pLKO.1 1526 CDS 100% 5.625 3.938 N CEP57L1 n/a
10 TRCN0000151396 GCTGAAGATAACCTGAACATT pLKO.1 1627 CDS 100% 5.625 3.938 N CEP57L1 n/a
11 TRCN0000155287 GCCCAAATAGCCAAGCTCTTA pLKO.1 1547 CDS 100% 4.950 2.970 N CEP57L1 n/a
12 TRCN0000155079 GCAAGAAGACAGCTACCCTAA pLKO.1 2622 CDS 100% 4.050 2.430 N CEP57L1 n/a
13 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 1272 5UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
14 TRCN0000375438 TCAGCCCAGTCTCGTTGTATT pLKO_005 1762 CDS 100% 13.200 18.480 N Cep57l1 n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 6454 3UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 6454 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350653.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05407 pDONR223 99% 100% 100% None n/a
2 ccsbBroad304_05407 pLX_304 0% 100% 100% V5 (not translated due to prior stop codon) n/a
3 ccsbBroadEn_14466 pDONR223 100% 54.1% 53.6% None (many diffs) n/a
4 ccsbBroad304_14466 pLX_304 0% 54.1% 53.6% V5 (not translated due to frame shift) (many diffs) n/a
5 TRCN0000475203 CGTCGGAGACTTGGCAAAATACGA pLX_317 62.6% 54.1% 53.6% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV