Transcript: Human NM_001350666.1

Homo sapiens centrosomal protein 57 like 1 (CEP57L1), transcript variant 19, mRNA.

Source:
NCBI, updated 2018-06-15
Taxon:
Homo sapiens (human)
Gene:
CEP57L1 (285753)
Length:
2573
CDS:
958..1665

Additional Resources:

NCBI RefSeq record:
NM_001350666.1
NBCI Gene record:
CEP57L1 (285753)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350666.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425654 GAACATCAGCGTAAGCTATTT pLKO_005 1528 CDS 100% 13.200 18.480 N CEP57L1 n/a
2 TRCN0000150697 GCTGAGGACAAGATTAAACAT pLKO.1 1483 CDS 100% 5.625 7.875 N CEP57L1 n/a
3 TRCN0000152263 CTAAGATACTTCATAGCCCAA pLKO.1 1088 CDS 100% 2.160 1.728 N CEP57L1 n/a
4 TRCN0000151881 CCTCTCCTAAGATACTTCATA pLKO.1 1082 CDS 100% 5.625 3.938 N CEP57L1 n/a
5 TRCN0000151396 GCTGAAGATAACCTGAACATT pLKO.1 1183 CDS 100% 5.625 3.938 N CEP57L1 n/a
6 TRCN0000155287 GCCCAAATAGCCAAGCTCTTA pLKO.1 1103 CDS 100% 4.950 2.970 N CEP57L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350666.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14466 pDONR223 100% 93.4% 92% None 338_339ins48;693delA n/a
2 ccsbBroad304_14466 pLX_304 0% 93.4% 92% V5 (not translated due to frame shift) 338_339ins48;693delA n/a
3 TRCN0000475203 CGTCGGAGACTTGGCAAAATACGA pLX_317 62.6% 93.4% 92% V5 (not translated due to frame shift) 338_339ins48;693delA n/a
4 ccsbBroadEn_05407 pDONR223 99% 50.7% 50.8% None (many diffs) n/a
5 ccsbBroad304_05407 pLX_304 0% 50.7% 50.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV