Transcript: Human NM_001350967.2

Homo sapiens DNA cross-link repair 1C (DCLRE1C), transcript variant l, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
DCLRE1C (64421)
Length:
3907
CDS:
532..2016

Additional Resources:

NCBI RefSeq record:
NM_001350967.2
NBCI Gene record:
DCLRE1C (64421)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350967.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083381 CCAGTGGGAAGTATTCTTTAA pLKO.1 1632 CDS 100% 13.200 18.480 N DCLRE1C n/a
2 TRCN0000276611 GATCCTCTGCCAATACCTTTA pLKO_005 1354 CDS 100% 10.800 15.120 N DCLRE1C n/a
3 TRCN0000276612 TATGGATAAAGTTGTCGAAAT pLKO_005 1212 CDS 100% 10.800 15.120 N DCLRE1C n/a
4 TRCN0000083382 CGTTTCACAAACTTTGTAGAT pLKO.1 1504 CDS 100% 4.950 6.930 N DCLRE1C n/a
5 TRCN0000083380 CTGTGGAATTACTTCCAGAAA pLKO.1 984 CDS 100% 0.495 0.347 N DCLRE1C n/a
6 TRCN0000276617 AGCGGCTTATGGCTATGAATA pLKO_005 792 CDS 100% 13.200 6.600 Y DCLRE1C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350967.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03949 pDONR223 100% 83.4% 80.3% None (many diffs) n/a
2 TRCN0000471456 TAGCCCTTTTAGGCTGACAGCTCG pLX_317 23.2% 83.4% 80.3% V5 (many diffs) n/a
3 ccsbBroadEn_12471 pDONR223 100% 47.4% 44.5% None (many diffs) n/a
4 ccsbBroad304_12471 pLX_304 0% 47.4% 44.5% V5 (many diffs) n/a
5 TRCN0000465585 AGAATCAACACGATTGCACTCCGA pLX_317 32.6% 47.4% 44.5% V5 (many diffs) n/a
Download CSV