Transcript: Human NM_001351369.1

Homo sapiens YEATS domain containing 2 (YEATS2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-02-25
Taxon:
Homo sapiens (human)
Gene:
YEATS2 (55689)
Length:
6383
CDS:
73..4341

Additional Resources:

NCBI RefSeq record:
NM_001351369.1
NBCI Gene record:
YEATS2 (55689)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351369.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140296 GCGAGCTACGAACAATGCTAA pLKO.1 2421 CDS 100% 4.950 6.930 N YEATS2 n/a
2 TRCN0000140478 GCAAGTTGTAACCCAAGGAGT pLKO.1 2142 CDS 100% 2.640 3.696 N YEATS2 n/a
3 TRCN0000419328 ACGCTGCACTCCAGATGAAAT pLKO_005 4495 3UTR 100% 13.200 10.560 N YEATS2 n/a
4 TRCN0000436759 CCAGCGTTTCTGCAGTCTTTG pLKO_005 4583 3UTR 100% 10.800 8.640 N YEATS2 n/a
5 TRCN0000417949 TCATTGACCAGCGACTGATTG pLKO_005 260 CDS 100% 10.800 8.640 N YEATS2 n/a
6 TRCN0000219064 TTCCTTCATCCTAGCTATAAA pLKO_005 841 CDS 100% 15.000 10.500 N Yeats2 n/a
7 TRCN0000431997 ATAACAGCAATATGGATATAG pLKO_005 536 CDS 100% 13.200 9.240 N YEATS2 n/a
8 TRCN0000144252 CGTCAGAGTTCAAGTTCATTT pLKO.1 930 CDS 100% 13.200 9.240 N YEATS2 n/a
9 TRCN0000219117 ACAAGCGGATAGATATCATAC pLKO_005 965 CDS 100% 10.800 7.560 N Yeats2 n/a
10 TRCN0000432505 AGTACAGGAAGTCCTACAAAC pLKO_005 1618 CDS 100% 10.800 7.560 N YEATS2 n/a
11 TRCN0000427271 ATTTGCCTCCTGGCACTAAAC pLKO_005 2327 CDS 100% 10.800 7.560 N YEATS2 n/a
12 TRCN0000144016 CCAGTCAGAAATCTGTTCTAT pLKO.1 5535 3UTR 100% 5.625 3.938 N YEATS2 n/a
13 TRCN0000142732 CGAGCCAGTGAAGATAAACAT pLKO.1 3972 CDS 100% 5.625 3.938 N YEATS2 n/a
14 TRCN0000144134 CCTAACTACAAACAGCAAGAA pLKO.1 2352 CDS 100% 4.950 3.465 N YEATS2 n/a
15 TRCN0000140368 GCCGAAATACTGGAAGGGATA pLKO.1 593 CDS 100% 4.050 2.835 N YEATS2 n/a
16 TRCN0000139940 GCTGCAAGATTGTGTCAGGTT pLKO.1 1445 CDS 100% 2.640 1.848 N YEATS2 n/a
17 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 5729 3UTR 100% 4.950 2.475 Y ERAP2 n/a
18 TRCN0000161892 GCCTGTAATTCCAGCTACTTA pLKO.1 5866 3UTR 100% 5.625 2.813 Y GPN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351369.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08565 pDONR223 100% 99.9% 99.8% None 1786G>T;1912G>T;3747C>T n/a
2 ccsbBroad304_08565 pLX_304 0% 99.9% 99.8% V5 1786G>T;1912G>T;3747C>T n/a
Download CSV