Transcript: Human NM_001351391.2

Homo sapiens dystrobrevin beta (DTNB), transcript variant 25, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
DTNB (1838)
Length:
2138
CDS:
194..1957

Additional Resources:

NCBI RefSeq record:
NM_001351391.2
NBCI Gene record:
DTNB (1838)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351391.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054199 CGAGGCAAGTTGACGGTATTT pLKO.1 563 CDS 100% 13.200 18.480 N DTNB n/a
2 TRCN0000054201 GCAGAGAAAGATAATGCTAAA pLKO.1 793 CDS 100% 10.800 15.120 N DTNB n/a
3 TRCN0000108761 GCCATGCAATTAGTAAATCTT pLKO.1 1092 CDS 100% 5.625 7.875 N Dtnb n/a
4 TRCN0000054202 CACCGTCTTATAGCTCGCTAT pLKO.1 1307 CDS 100% 4.050 5.670 N DTNB n/a
5 TRCN0000433001 GTCATACGACTATCAACTTAC pLKO_005 278 CDS 100% 10.800 8.640 N DTNB n/a
6 TRCN0000412626 TCCAATGGCTTAATGATATTT pLKO_005 665 CDS 100% 15.000 10.500 N DTNB n/a
7 TRCN0000416464 CTGAGCCATGCAATTAGTAAA pLKO_005 1088 CDS 100% 13.200 9.240 N DTNB n/a
8 TRCN0000429415 ATTAGTGTGGAACAATCTATC pLKO_005 497 CDS 100% 10.800 7.560 N DTNB n/a
9 TRCN0000054200 GCAACCTTCATCTTGTTGATA pLKO.1 336 CDS 100% 5.625 3.938 N DTNB n/a
10 TRCN0000054198 GCCTGCAAATTACGATTTGTA pLKO.1 305 CDS 100% 0.563 0.394 N DTNB n/a
11 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 2046 3UTR 100% 4.950 2.475 Y CFLAR n/a
12 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 2046 3UTR 100% 4.950 2.475 Y C19orf31 n/a
13 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 2044 3UTR 100% 4.950 2.475 Y ERN2 n/a
14 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 2044 3UTR 100% 4.950 2.475 Y P3H4 n/a
15 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 2044 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351391.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00465 pDONR223 100% 93.2% 90.3% None (many diffs) n/a
2 ccsbBroad304_00465 pLX_304 0% 93.2% 90.3% V5 (many diffs) n/a
3 TRCN0000470172 TAGCTCTCCGCGAGATGAGTTAGG pLX_317 25.2% 93.2% 90.3% V5 (many diffs) n/a
Download CSV