Transcript: Human NM_001351506.1

Homo sapiens nuclear cap binding protein subunit 1 (NCBP1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
NCBP1 (4686)
Length:
5333
CDS:
967..2769

Additional Resources:

NCBI RefSeq record:
NM_001351506.1
NBCI Gene record:
NCBP1 (4686)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351506.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059506 GCACTCTACAATTCGTAAGAT pLKO.1 2319 CDS 100% 5.625 7.875 N NCBP1 n/a
2 TRCN0000059505 CCTCGTTATATTTCAGCGGTT pLKO.1 2526 CDS 100% 2.160 3.024 N NCBP1 n/a
3 TRCN0000246119 CGTTATATTTCAGCGGTTTAT pLKO_005 2529 CDS 100% 13.200 10.560 N NCBP1 n/a
4 TRCN0000246118 GTCAACCTTACATAGTATATA pLKO_005 3084 3UTR 100% 15.000 10.500 N NCBP1 n/a
5 TRCN0000246117 GTCTTACCATCAGCGTATATT pLKO_005 1773 CDS 100% 15.000 10.500 N NCBP1 n/a
6 TRCN0000246121 ACTACAAGAGCAAGATCTTAA pLKO_005 647 5UTR 100% 13.200 9.240 N NCBP1 n/a
7 TRCN0000059507 CCAACACTGAAAGCTATCTTA pLKO.1 1078 CDS 100% 5.625 3.938 N NCBP1 n/a
8 TRCN0000059503 GCGACGAGATTGGTATGTGTA pLKO.1 980 CDS 100% 4.950 3.465 N NCBP1 n/a
9 TRCN0000059504 CCCTTGAACTACCACATAGTT pLKO.1 1432 CDS 100% 0.563 0.394 N NCBP1 n/a
10 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 4436 3UTR 100% 4.950 2.475 Y ERAP2 n/a
11 TRCN0000138140 GATTGAGACCATCCTGGCTAA pLKO.1 4491 3UTR 100% 4.050 2.025 Y LOC441087 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4437 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351506.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14708 pDONR223 60.4% 75.9% 65.6% None 0_1ins478;201_202ins92;861T>C n/a
2 ccsbBroad304_14708 pLX_304 0% 75.9% 65.6% V5 0_1ins478;201_202ins92;861T>C n/a
Download CSV