Transcript: Human NM_001352165.1

Homo sapiens limb development membrane protein 1 like (LMBR1L), transcript variant 8, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
LMBR1L (55716)
Length:
2170
CDS:
549..1637

Additional Resources:

NCBI RefSeq record:
NM_001352165.1
NBCI Gene record:
LMBR1L (55716)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001352165.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236314 ATAGCCATGTTTACATGATTT pLKO_005 1936 3UTR 100% 13.200 18.480 N LMBR1L n/a
2 TRCN0000236315 GAGAGGATCCGCGAGTGTATT pLKO_005 253 5UTR 100% 13.200 18.480 N LMBR1L n/a
3 TRCN0000063472 ACTGCCATGACGCAGATAATT pLKO.1 1326 CDS 100% 15.000 10.500 N LMBR1L n/a
4 TRCN0000236312 GCACCTTTACCCTGGCAATTG pLKO_005 370 5UTR 100% 10.800 7.560 N LMBR1L n/a
5 TRCN0000126109 GCCATGTTTACATGATTTGAT pLKO.1 1939 3UTR 100% 5.625 3.938 N Lmbr1l n/a
6 TRCN0000353810 GCCATGTTTACATGATTTGAT pLKO_005 1939 3UTR 100% 5.625 3.938 N Lmbr1l n/a
7 TRCN0000063468 GCCAACAGAGAGTCACTCTAT pLKO.1 708 CDS 100% 4.950 3.465 N LMBR1L n/a
8 TRCN0000063470 CCTTTAGACATGGAGCTGCTA pLKO.1 957 CDS 100% 2.640 1.848 N LMBR1L n/a
9 TRCN0000063469 GCAGGATCTGTAATCCTACTT pLKO.1 925 CDS 100% 0.495 0.347 N LMBR1L n/a
10 TRCN0000236316 ACACTGCCATGACGCAGATAA pLKO_005 1324 CDS 100% 13.200 7.920 N LMBR1L n/a
11 TRCN0000236313 TTCAACTGGCTGGGCAATTTC pLKO_005 1446 CDS 100% 13.200 7.920 N LMBR1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001352165.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15910 pDONR223 0% 74% 74% None 0_1ins381 n/a
2 ccsbBroad304_15910 pLX_304 0% 74% 74% V5 0_1ins381 n/a
3 TRCN0000469583 TTCAGCGCCCAATACCCGCTGGTA pLX_317 29.9% 74% 74% V5 0_1ins381 n/a
4 ccsbBroadEn_08568 pDONR223 100% 73.9% 74% None 0_1ins381;561G>T n/a
5 ccsbBroad304_08568 pLX_304 0% 73.9% 74% V5 0_1ins381;561G>T n/a
6 TRCN0000478741 TACAGCTGCTGTGGGTCAATCCGC pLX_317 18.4% 73.9% 74% V5 0_1ins381;561G>T n/a
7 ccsbBroadEn_12258 pDONR223 100% 69.8% 69.7% None 0_1ins381;250G>T;625_684del n/a
8 ccsbBroad304_12258 pLX_304 0% 69.8% 69.7% V5 0_1ins381;250G>T;625_684del n/a
9 TRCN0000480182 TGTGATTCGCAGACCTGGGCTGCC pLX_317 23.8% 69.8% 69.7% V5 0_1ins381;250G>T;625_684del n/a
Download CSV