Transcript: Human NM_001352312.2

Homo sapiens La ribonucleoprotein 4 (LARP4), transcript variant 16, mRNA.

Source:
NCBI, updated 2019-08-29
Taxon:
Homo sapiens (human)
Gene:
LARP4 (113251)
Length:
6490
CDS:
386..2350

Additional Resources:

NCBI RefSeq record:
NM_001352312.2
NBCI Gene record:
LARP4 (113251)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001352312.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275017 CAAGGGCTAGTAAGGATTATT pLKO_005 2184 CDS 100% 15.000 21.000 N LARP4 n/a
2 TRCN0000160140 CCAAGTCATAAGCGTTGTATT pLKO.1 755 CDS 100% 13.200 18.480 N LARP4 n/a
3 TRCN0000275019 CCAAGTCATAAGCGTTGTATT pLKO_005 755 CDS 100% 13.200 18.480 N LARP4 n/a
4 TRCN0000252018 CTAAGAATGGTTATCGATTAA pLKO_005 1011 CDS 100% 13.200 18.480 N Larp4 n/a
5 TRCN0000161967 GCACACAATAGCAACTGGTAT pLKO.1 872 CDS 100% 4.950 6.930 N LARP4 n/a
6 TRCN0000164286 CCTGAGAACTCCGTTGAGAAA pLKO.1 2144 CDS 100% 4.950 3.960 N LARP4 n/a
7 TRCN0000274949 CCTGAGAACTCCGTTGAGAAA pLKO_005 2144 CDS 100% 4.950 3.960 N LARP4 n/a
8 TRCN0000164215 CCCAATTTGGACAGTTGCCAA pLKO.1 631 CDS 100% 2.640 2.112 N LARP4 n/a
9 TRCN0000274951 TAATTCGCCAGGATCTTATAA pLKO_005 1228 CDS 100% 15.000 10.500 N LARP4 n/a
10 TRCN0000275018 ACTTGAACTGTGGCTATATTG pLKO_005 2394 3UTR 100% 13.200 9.240 N LARP4 n/a
11 TRCN0000160572 CCTTTGAAATTCACCTGATTA pLKO.1 6045 3UTR 100% 13.200 9.240 N LARP4 n/a
12 TRCN0000159791 GCGTTGGATTTCAGAGAATAA pLKO.1 4425 3UTR 100% 13.200 9.240 N LARP4 n/a
13 TRCN0000159319 GCCTCATTACATCTAATAGTT pLKO.1 4751 3UTR 100% 5.625 3.938 N LARP4 n/a
14 TRCN0000161048 GCTTTAATTCGCCAGGATCTT pLKO.1 1224 CDS 100% 4.950 3.465 N LARP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001352312.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13020 pDONR223 100% 41.9% 41.7% None 0_1ins210;902delA;914_1962del n/a
2 ccsbBroad304_13020 pLX_304 0% 41.9% 41.7% V5 0_1ins210;902delA;914_1962del n/a
3 TRCN0000467269 GATAATGCTGATCCTGAGGGTGGA pLX_317 40.6% 41.9% 41.7% V5 0_1ins210;902delA;914_1962del n/a
4 ccsbBroadEn_13021 pDONR223 100% 28.7% 27.9% None 547_548delAA;567_1962del n/a
5 ccsbBroad304_13021 pLX_304 0% 28.7% 27.9% V5 547_548delAA;567_1962del n/a
6 TRCN0000479126 CATTTTTATGGCAGGAAGATCATG pLX_317 73.6% 28.7% 27.9% V5 547_548delAA;567_1962del n/a
Download CSV