Transcript: Human NM_001352498.1

Homo sapiens zinc finger protein 75a (ZNF75A), transcript variant 8, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
ZNF75A (7627)
Length:
3233
CDS:
1990..2526

Additional Resources:

NCBI RefSeq record:
NM_001352498.1
NBCI Gene record:
ZNF75A (7627)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001352498.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020247 CAACAGTGTGATAAGAGGTTT pLKO.1 2209 CDS 100% 4.950 6.930 N ZNF75A n/a
2 TRCN0000020248 GTTTAAGGATAGTGCCGGAAA pLKO.1 1815 5UTR 100% 4.050 5.670 N ZNF75A n/a
3 TRCN0000418857 TCACTTGAGTTCCTTCTTAAA pLKO_005 2968 3UTR 100% 13.200 10.560 N ZNF75A n/a
4 TRCN0000020246 CAGCCATATACTTGTAGCATA pLKO.1 2446 CDS 100% 4.950 3.960 N ZNF75A n/a
5 TRCN0000430002 CAGTAGCAGGCTTACCAATTT pLKO_005 2844 3UTR 100% 13.200 9.240 N ZNF75A n/a
6 TRCN0000020245 CCTAAAGTGATCTCCTGTCTA pLKO.1 1756 5UTR 100% 4.950 3.465 N ZNF75A n/a
7 TRCN0000020244 CCTGTGTCTCTTTCTGACTTA pLKO.1 1882 5UTR 100% 4.950 3.465 N ZNF75A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001352498.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01805 pDONR223 100% 60.1% 60.1% None 0_1ins354 n/a
2 ccsbBroad304_01805 pLX_304 0% 60.1% 60.1% V5 0_1ins354 n/a
3 TRCN0000474225 AATACCATGACCAACAATAAGCCC pLX_317 52% 60.1% 60.1% V5 0_1ins354 n/a
4 ccsbBroadEn_07159 pDONR223 100% 30.2% 28.4% None (many diffs) n/a
5 TRCN0000472508 GGTGATACTGCGAACGACAATGGC pLX_317 30.1% 30.2% 28.4% V5 (many diffs) n/a
Download CSV