Transcript: Human NM_001352634.2

Homo sapiens pericentriolar material 1 (PCM1), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
PCM1 (5108)
Length:
8664
CDS:
292..6378

Additional Resources:

NCBI RefSeq record:
NM_001352634.2
NBCI Gene record:
PCM1 (5108)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001352634.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322932 AGCTTTGCGAGATACTATTTA pLKO_005 4428 CDS 100% 15.000 21.000 N PCM1 n/a
2 TRCN0000322935 TTGTTCAAATTCGCGATTATA pLKO_005 917 CDS 100% 15.000 21.000 N PCM1 n/a
3 TRCN0000118948 GCGGATAAACTTCAGTGATTT pLKO.1 606 CDS 100% 13.200 18.480 N PCM1 n/a
4 TRCN0000322931 AGATGCACCTGCAGGATTATT pLKO_005 4912 CDS 100% 15.000 10.500 N PCM1 n/a
5 TRCN0000322934 TGATGTTTGGTAACGAATTTA pLKO_005 6630 3UTR 100% 15.000 10.500 N PCM1 n/a
6 TRCN0000322863 CAGTAGGACACCATGGTTATA pLKO_005 3909 CDS 100% 13.200 9.240 N PCM1 n/a
7 TRCN0000118949 CGGATAAACTTCAGTGATTTA pLKO.1 607 CDS 100% 13.200 9.240 N PCM1 n/a
8 TRCN0000118950 CCATTTATCAAGACTGGATTT pLKO.1 3955 CDS 100% 10.800 7.560 N PCM1 n/a
9 TRCN0000118951 GCAGCTACTAAACACAGACTA pLKO.1 4521 CDS 100% 4.950 3.465 N PCM1 n/a
10 TRCN0000118947 GCTCATCTAACTCTGTCCTTA pLKO.1 6392 3UTR 100% 4.950 3.465 N PCM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001352634.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11020 pDONR223 100% 23.7% 23.7% None 476_477delACinsGT;783_784ins117;1474_6084del n/a
2 ccsbBroad304_11020 pLX_304 0% 23.7% 23.7% V5 476_477delACinsGT;783_784ins117;1474_6084del n/a
3 TRCN0000467367 ACTCGGGGTTTTGCCCGAAGCCTT pLX_317 19.5% 23.7% 23.7% V5 476_477delACinsGT;783_784ins117;1474_6084del n/a
Download CSV