Transcript: Human NM_001352660.1

Homo sapiens pericentriolar material 1 (PCM1), transcript variant 32, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
PCM1 (5108)
Length:
2645
CDS:
760..2352

Additional Resources:

NCBI RefSeq record:
NM_001352660.1
NBCI Gene record:
PCM1 (5108)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001352660.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322935 TTGTTCAAATTCGCGATTATA pLKO_005 1385 CDS 100% 15.000 21.000 N PCM1 n/a
2 TRCN0000118948 GCGGATAAACTTCAGTGATTT pLKO.1 1074 CDS 100% 13.200 18.480 N PCM1 n/a
3 TRCN0000118949 CGGATAAACTTCAGTGATTTA pLKO.1 1075 CDS 100% 13.200 9.240 N PCM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001352660.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11020 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_11020 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467367 ACTCGGGGTTTTGCCCGAAGCCTT pLX_317 19.5% 100% 100% V5 n/a
Download CSV