Transcript: Human NM_001352797.2

Homo sapiens transforming acidic coiled-coil containing protein 1 (TACC1), transcript variant 24, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
TACC1 (6867)
Length:
7371
CDS:
621..2366

Additional Resources:

NCBI RefSeq record:
NM_001352797.2
NBCI Gene record:
TACC1 (6867)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001352797.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285450 GAAGGCAAAGTCGCGTTTAAT pLKO_005 1403 CDS 100% 15.000 21.000 N TACC1 n/a
2 TRCN0000154462 GCTCGGATTCTGAAGGTAATT pLKO.1 196 5UTR 100% 13.200 18.480 N TACC1 n/a
3 TRCN0000154853 GCCAAAGTGTAGATAGCCTTT pLKO.1 5259 3UTR 100% 4.050 5.670 N TACC1 n/a
4 TRCN0000275915 GCCAAAGTGTAGATAGCCTTT pLKO_005 5259 3UTR 100% 4.050 5.670 N TACC1 n/a
5 TRCN0000157354 CCACGTCATGTGGTCAGAAAT pLKO.1 1567 CDS 100% 13.200 9.240 N TACC1 n/a
6 TRCN0000275917 CCACGTCATGTGGTCAGAAAT pLKO_005 1567 CDS 100% 13.200 9.240 N TACC1 n/a
7 TRCN0000275856 CTCCGCAGAAGCTGATCTAAA pLKO_005 656 CDS 100% 13.200 9.240 N TACC1 n/a
8 TRCN0000155998 CAGGATTACTTAGCCAGAGTT pLKO.1 2097 CDS 100% 4.950 3.465 N TACC1 n/a
9 TRCN0000155122 CATCAGTAAGTCAGCAGGTTT pLKO.1 1106 CDS 100% 4.950 3.465 N TACC1 n/a
10 TRCN0000275855 CATCAGTAAGTCAGCAGGTTT pLKO_005 1106 CDS 100% 4.950 3.465 N TACC1 n/a
11 TRCN0000155270 GACAAGTATGACCTCTCAGAA pLKO.1 1922 CDS 100% 4.950 3.465 N TACC1 n/a
12 TRCN0000157519 GCATCAGTAAGTCAGCAGGTT pLKO.1 1105 CDS 100% 2.640 1.848 N TACC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001352797.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11168 pDONR223 100% 79.2% 79.3% None (many diffs) n/a
2 ccsbBroad304_11168 pLX_304 0% 79.2% 79.3% V5 (many diffs) n/a
3 TRCN0000478540 TGCCTAACGCTTCCGTTGCCGGAC pLX_317 16.1% 79.2% 79.3% V5 (many diffs) n/a
Download CSV