Transcript: Human NM_001352903.2

Homo sapiens arylsulfatase G (ARSG), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ARSG (22901)
Length:
4651
CDS:
809..2383

Additional Resources:

NCBI RefSeq record:
NM_001352903.2
NBCI Gene record:
ARSG (22901)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148698 AGGTAAGGGCACGTGCATGT pXPR_003 GGG 745 47% 7 1.207 ARSG ARSG 77642
2 BRDN0001147989 TCCAGCCAAGCAGACGACCT pXPR_003 GGG 1003 64% 9 0.3699 ARSG ARSG 77640
3 BRDN0001147874 CACAGGGTGATGGACCATCA pXPR_003 AGG 561 36% 5 0.2385 ARSG ARSG 77641
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001352903.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358764 GTTACGTCACTGGGATAATAG pLKO_005 1194 CDS 100% 13.200 18.480 N ARSG n/a
2 TRCN0000051347 CACGCAACTTTGCAGTCACTT pLKO.1 1116 CDS 100% 4.950 6.930 N ARSG n/a
3 TRCN0000358697 CAACATCTCCAGCGCAGATTA pLKO_005 2293 CDS 100% 13.200 9.240 N ARSG n/a
4 TRCN0000358699 CTACTTTGGAATCCCATATAG pLKO_005 1273 CDS 100% 13.200 9.240 N ARSG n/a
5 TRCN0000358698 ATGGAGTCACACGCAACTTTG pLKO_005 1107 CDS 100% 10.800 7.560 N ARSG n/a
6 TRCN0000051346 CCTCTGGTTTACAGGAGACAA pLKO.1 1693 CDS 100% 4.950 3.465 N ARSG n/a
7 TRCN0000051343 CCTGCTGTAATCCCTACCAAA pLKO.1 2337 CDS 100% 4.950 3.465 N ARSG n/a
8 TRCN0000051344 GCAGCATAAGTTTCCTCTGAT pLKO.1 2149 CDS 100% 4.950 3.465 N ARSG n/a
9 TRCN0000051345 CCAACCTTGATAAGATGGCTT pLKO.1 993 CDS 100% 2.640 1.848 N ARSG n/a
10 TRCN0000139012 CGCCTGTAATCCCAGAACTTT pLKO.1 4085 3UTR 100% 5.625 2.813 Y CCDC57 n/a
11 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 4389 3UTR 100% 4.950 2.475 Y CFLAR n/a
12 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 4389 3UTR 100% 4.950 2.475 Y C19orf31 n/a
13 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 4387 3UTR 100% 4.950 2.475 Y ERN2 n/a
14 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 4387 3UTR 100% 4.950 2.475 Y P3H4 n/a
15 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 4387 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001352903.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02699 pDONR223 100% 99.8% 99.8% None 704_705insCAC n/a
2 ccsbBroad304_02699 pLX_304 0% 99.8% 99.8% V5 704_705insCAC n/a
3 TRCN0000469774 ACAAAAGAGATATGAGTGGAACCG pLX_317 25.2% 99.8% 99.8% V5 704_705insCAC n/a
4 ccsbBroadEn_14999 pDONR223 0% 99.8% 99.8% None 704_705insCAC n/a
5 ccsbBroad304_14999 pLX_304 0% 99.8% 99.8% V5 704_705insCAC n/a
6 TRCN0000466305 CGATAGACTCGCTCTCTATTGGCC pLX_317 18.6% 99.8% 99.8% V5 704_705insCAC n/a
Download CSV