Transcript: Human NM_001353047.2

Homo sapiens cell division cycle 27 (CDC27), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
CDC27 (996)
Length:
5763
CDS:
124..2430

Additional Resources:

NCBI RefSeq record:
NM_001353047.2
NBCI Gene record:
CDC27 (996)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001353047.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275382 CGCTTATGCCTATACTCTATT pLKO_005 1920 CDS 100% 13.200 10.560 N CDC27 n/a
2 TRCN0000275425 CAAGTACCTAATCATAGTTTA pLKO_005 682 CDS 100% 13.200 9.240 N CDC27 n/a
3 TRCN0000144846 GCCTATAACAGTGACTTGATT pLKO.1 3018 3UTR 100% 5.625 3.938 N CDC27 n/a
4 TRCN0000141913 CCAGAGTTTCTTGGTTGCTTT pLKO.1 2882 3UTR 100% 4.950 3.465 N CDC27 n/a
5 TRCN0000275426 CCAGAGTTTCTTGGTTGCTTT pLKO_005 2882 3UTR 100% 4.950 3.465 N CDC27 n/a
6 TRCN0000144075 CGAAATGCTATCAGAGTCAAT pLKO.1 1993 CDS 100% 4.950 2.970 N CDC27 n/a
7 TRCN0000142701 CCAGATCCTGACCAAACATTT pLKO.1 607 CDS 100% 13.200 6.600 Y CDC27 n/a
8 TRCN0000275428 CCAGATCCTGACCAAACATTT pLKO_005 607 CDS 100% 13.200 6.600 Y CDC27 n/a
9 TRCN0000285364 GATGAGCCTTCTTCGTGAAAT pLKO_005 1506 CDS 100% 13.200 6.600 Y CDC27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001353047.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05973 pDONR223 100% 92.4% 89.7% None (many diffs) n/a
2 ccsbBroad304_05973 pLX_304 0% 92.4% 89.7% V5 (many diffs) n/a
3 TRCN0000479954 TGTATTTACTAAAAAATATTCCCA pLX_317 14% 92.4% 89.7% V5 (many diffs) n/a
Download CSV