Transcript: Human NM_001353551.1

Homo sapiens zinc finger protein 44 (ZNF44), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
ZNF44 (51710)
Length:
2761
CDS:
411..2162

Additional Resources:

NCBI RefSeq record:
NM_001353551.1
NBCI Gene record:
ZNF44 (51710)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001353551.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364643 CTTAAGCCAGATTCGAAATAG pLKO_005 563 CDS 100% 13.200 18.480 N ZNF44 n/a
2 TRCN0000369363 ATCTTATGAGTGTCAAATTTG pLKO_005 1820 CDS 100% 13.200 9.240 N ZNF44 n/a
3 TRCN0000364642 CACCGGGAGTGTCATGAATAT pLKO_005 702 CDS 100% 13.200 9.240 N ZNF44 n/a
4 TRCN0000369364 CACTGGAAGGATATTCTATAA pLKO_005 2142 CDS 100% 13.200 9.240 N ZNF44 n/a
5 TRCN0000017006 CAGTGTGAATGGAGAAGTCAT pLKO.1 629 CDS 100% 4.950 3.465 N ZNF44 n/a
6 TRCN0000017004 CCCTCTTTCCTTCTAAGACAT pLKO.1 1944 CDS 100% 4.950 3.465 N ZNF44 n/a
7 TRCN0000017003 GCCCTCATAAATGCACAGTAT pLKO.1 1486 CDS 100% 4.950 3.465 N ZNF44 n/a
8 TRCN0000364566 AGAGTTGCTGCCTGCTATATG pLKO_005 2590 3UTR 100% 13.200 7.920 N ZNF44 n/a
9 TRCN0000369288 TGTGAATGTAAACGTGGTAAA pLKO_005 2229 3UTR 100% 10.800 6.480 N ZNF44 n/a
10 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 1141 CDS 100% 13.200 6.600 Y Zfp934 n/a
11 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 1141 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
12 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 1141 CDS 100% 13.200 6.600 Y EG668616 n/a
13 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 2286 3UTR 100% 4.950 2.475 Y CFLAR n/a
14 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 2286 3UTR 100% 4.950 2.475 Y C19orf31 n/a
15 TRCN0000016346 CACTGGAGAGAAACCCTACAA pLKO.1 1139 CDS 100% 4.950 2.475 Y ZNF254 n/a
16 TRCN0000151775 CCCTATGAATGTAAGGAATGT pLKO.1 2073 CDS 100% 4.950 2.475 Y ZNF829 n/a
17 TRCN0000147970 GAATGTAAGGAATGTGGGAAA pLKO.1 2079 CDS 100% 4.050 2.025 Y ZNF700 n/a
18 TRCN0000218427 ACTGGAGAGAAACCCTATAAA pLKO_005 1224 CDS 100% 15.000 7.500 Y ZNF443 n/a
19 TRCN0000374174 ACTGGAGAGAAACCCTATAAA pLKO_005 1224 CDS 100% 15.000 7.500 Y Zfp97 n/a
20 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 1562 CDS 100% 13.200 6.600 Y Zfp977 n/a
21 TRCN0000160334 CCTATGAATGTAAGGAATGTA pLKO.1 2074 CDS 100% 5.625 2.813 Y ZNF570 n/a
22 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 2284 3UTR 100% 4.950 2.475 Y ERN2 n/a
23 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 2284 3UTR 100% 4.950 2.475 Y P3H4 n/a
24 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 2284 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001353551.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.