Transcript: Human NM_001353625.2

Homo sapiens chromosome 12 open reading frame 49 (C12orf49), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
C12orf49 (79794)
Length:
8003
CDS:
170..364

Additional Resources:

NCBI RefSeq record:
NM_001353625.2
NBCI Gene record:
C12orf49 (79794)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001353625.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005086 GCCATTCTAGTTGAATATGTT pLKO.1 807 3UTR 100% 5.625 7.875 N C12orf49 n/a
2 TRCN0000005087 CCCATAGCAAAGTATTGCTAT pLKO.1 311 CDS 100% 0.495 0.693 N C12orf49 n/a
3 TRCN0000164978 GTGGTGGCTTATGCCTGTAAT pLKO.1 2949 3UTR 100% 13.200 6.600 Y C9orf139 n/a
4 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 6279 3UTR 100% 4.950 2.475 Y CFLAR n/a
5 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 6279 3UTR 100% 4.950 2.475 Y C19orf31 n/a
6 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2961 3UTR 100% 13.200 6.600 Y LIAS n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 6880 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 6277 3UTR 100% 4.950 2.475 Y ERN2 n/a
9 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 6277 3UTR 100% 4.950 2.475 Y P3H4 n/a
10 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 6277 3UTR 100% 4.950 2.475 Y P3H4 n/a
11 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 3453 3UTR 100% 4.950 2.475 Y C16orf89 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 6880 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001353625.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04127 pDONR223 100% 31.2% 31.2% None 108_109ins423 n/a
2 ccsbBroad304_04127 pLX_304 0% 31.2% 31.2% V5 108_109ins423 n/a
3 TRCN0000473525 TGCCTCACACACTTATAGATCAGG pLX_317 76.2% 31.2% 31.2% V5 108_109ins423 n/a
Download CSV