Transcript: Human NM_001353674.2

Homo sapiens WD repeat domain 20 (WDR20), transcript variant 30, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
WDR20 (91833)
Length:
2199
CDS:
362..1552

Additional Resources:

NCBI RefSeq record:
NM_001353674.2
NBCI Gene record:
WDR20 (91833)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001353674.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138725 GTCACGAGTTACCTGTGTCAA pLKO.1 289 5UTR 100% 4.950 6.930 N WDR20 n/a
2 TRCN0000136913 CGAGAAAGATCACAAGCGAAA pLKO.1 1264 CDS 100% 4.050 5.670 N WDR20 n/a
3 TRCN0000138946 GTGTCACGTATCGGTTTGGTT pLKO.1 933 CDS 100% 3.000 4.200 N WDR20 n/a
4 TRCN0000138371 CGTAAGTGTCACGTATCGGTT pLKO.1 928 CDS 100% 2.640 3.696 N WDR20 n/a
5 TRCN0000137201 GCGCTCCTGTATTAGACTATT pLKO.1 1812 3UTR 100% 13.200 10.560 N WDR20 n/a
6 TRCN0000279180 AGTGGGAACATGTACTTATAT pLKO_005 353 5UTR 100% 15.000 10.500 N Wdr20 n/a
7 TRCN0000138658 CCTTGTTAGAGCCGCTGATAT pLKO.1 1404 CDS 100% 13.200 9.240 N WDR20 n/a
8 TRCN0000297624 CACGAGGAACCCTCTCCTTAA pLKO_005 466 CDS 100% 10.800 7.560 N Wdr20 n/a
9 TRCN0000134401 GAACGAGATTAAGACCCAATT pLKO.1 57 5UTR 100% 10.800 7.560 N WDR20 n/a
10 TRCN0000136764 CAATGTGTGTTCAGCACAGAT pLKO.1 1956 3UTR 100% 4.950 3.465 N WDR20 n/a
11 TRCN0000137293 GCACCAGATCTAGAACTTGAA pLKO.1 1557 3UTR 100% 4.950 3.465 N WDR20 n/a
12 TRCN0000134589 GCATGCCATGTAATTCTGAAT pLKO.1 1692 3UTR 100% 4.950 3.465 N WDR20 n/a
13 TRCN0000198907 GCTGCACCAGATCTAGAACTT pLKO.1 1554 3UTR 100% 4.950 3.465 N Wdr20rt n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001353674.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09322 pDONR223 100% 69.5% 69.5% None 0_1ins519 n/a
2 ccsbBroad304_09322 pLX_304 0% 69.5% 69.5% V5 0_1ins519 n/a
3 TRCN0000471560 TTCCTTGAGCATGCGAAAGCAATC pLX_317 25.1% 69.5% 69.5% V5 0_1ins519 n/a
Download CSV