Transcript: Human NM_001353685.1

Homo sapiens TIAM Rac1 associated GEF 1 (TIAM1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TIAM1 (7074)
Length:
4156
CDS:
407..2206

Additional Resources:

NCBI RefSeq record:
NM_001353685.1
NBCI Gene record:
TIAM1 (7074)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001353685.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039656 CGCACCTACGTGAAGGATTTA pLKO.1 587 CDS 100% 13.200 18.480 N TIAM1 n/a
2 TRCN0000039653 CCGTAGAGAATGTGTGTAGAT pLKO.1 2221 3UTR 100% 4.950 6.930 N TIAM1 n/a
3 TRCN0000018357 TAGATACTTCCTGCCCTAACT pLKO.1 2237 3UTR 100% 4.950 6.930 N TIAM1 n/a
4 TRCN0000256948 TAGTAGCTTTAGGAGTTATAT pLKO_005 3614 3UTR 100% 15.000 10.500 N TIAM1 n/a
5 TRCN0000267657 GCTTGAGAAGGTTGATCAATT pLKO_005 772 CDS 100% 13.200 9.240 N TIAM1 n/a
6 TRCN0000009870 GACATCAAGGAGACAGACATC pLKO.1 1922 CDS 100% 4.050 2.835 N TIAM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001353685.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000476458 CAACCAGGCTTTAGGCAGGCCGTC pLX_317 7.4% 36.6% 36% V5 (many diffs) n/a
Download CSV