Transcript: Human NM_001353907.1

Homo sapiens katanin catalytic subunit A1 like 2 (KATNAL2), transcript variant 10, mRNA.

Source:
NCBI, updated 2018-12-12
Taxon:
Homo sapiens (human)
Gene:
KATNAL2 (83473)
Length:
2634
CDS:
895..1950

Additional Resources:

NCBI RefSeq record:
NM_001353907.1
NBCI Gene record:
KATNAL2 (83473)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001353907.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117304 CGCTCAGAAGATCTCGTATTT pLKO.1 1726 CDS 100% 13.200 18.480 N KATNAL2 n/a
2 TRCN0000117306 GTTGTGTATCCTATAAGGTAT pLKO.1 1369 CDS 100% 4.950 6.930 N KATNAL2 n/a
3 TRCN0000090749 CGGGACATTTATCTCCATAAT pLKO.1 1285 CDS 100% 13.200 9.240 N Katnal2 n/a
4 TRCN0000117305 GCTCAATAAGGAGCATCCTAA pLKO.1 987 CDS 100% 4.950 3.465 N KATNAL2 n/a
5 TRCN0000117303 CCACAGCTATTTACAGGAATT pLKO.1 1390 CDS 100% 0.000 0.000 N KATNAL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001353907.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09098 pDONR223 100% 69.2% 65.9% None (many diffs) n/a
2 ccsbBroad304_09098 pLX_304 0% 69.2% 65.9% V5 (many diffs) n/a
3 TRCN0000478313 AGCACCATTAGGCTCGGACTTCCG pLX_317 20.4% 69.2% 64.9% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV