Transcript: Human NM_001354054.2

Homo sapiens Rho guanine nucleotide exchange factor 7 (ARHGEF7), transcript variant 20, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
ARHGEF7 (8874)
Length:
4958
CDS:
363..2339

Additional Resources:

NCBI RefSeq record:
NM_001354054.2
NBCI Gene record:
ARHGEF7 (8874)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354054.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303832 GAGTCTTGTGGATACCGTATA pLKO_005 2162 CDS 100% 10.800 15.120 N ARHGEF7 n/a
2 TRCN0000047593 GCCCTCCCAAAGGATTTGATA pLKO.1 598 CDS 100% 5.625 7.875 N ARHGEF7 n/a
3 TRCN0000047594 GCGGATATTAGTGTCGTGCAA pLKO.1 1490 CDS 100% 2.640 3.696 N ARHGEF7 n/a
4 TRCN0000303860 AGAGACACATGGAGGATTATC pLKO_005 1090 CDS 100% 13.200 9.240 N ARHGEF7 n/a
5 TRCN0000305803 AGAGACACATGGAGGATTATC pLKO_005 1090 CDS 100% 13.200 9.240 N Arhgef7 n/a
6 TRCN0000310774 TGCGAATGGAGACGATCAAAC pLKO_005 2488 3UTR 100% 10.800 7.560 N ARHGEF7 n/a
7 TRCN0000047595 CCTGGGATGAGACCAATCTAT pLKO.1 2317 CDS 100% 5.625 3.938 N ARHGEF7 n/a
8 TRCN0000047596 GAAGTTAAGTTCAGCAAACAT pLKO.1 743 CDS 100% 5.625 3.938 N ARHGEF7 n/a
9 TRCN0000300058 GAAGTTAAGTTCAGCAAACAT pLKO_005 743 CDS 100% 5.625 3.938 N ARHGEF7 n/a
10 TRCN0000303775 ACTGGGAGGGCGATGACATTA pLKO_005 1231 CDS 100% 13.200 7.920 N ARHGEF7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354054.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07317 pDONR223 100% 72.7% 70.7% None (many diffs) n/a
2 ccsbBroad304_07317 pLX_304 0% 72.7% 70.7% V5 (many diffs) n/a
3 TRCN0000474600 ATGTATAGCGCCCTCCCCCCGCCC pLX_317 16.8% 72.7% 70.7% V5 (many diffs) n/a
4 ccsbBroadEn_02036 pDONR223 100% 68.6% 66.7% None (many diffs) n/a
5 ccsbBroad304_02036 pLX_304 0% 68.6% 66.7% V5 (many diffs) n/a
6 TRCN0000479549 CAGCCCGAGTTGTATTTCACCCGA pLX_317 16% 68.6% 66.7% V5 (many diffs) n/a
Download CSV