Transcript: Human NM_001354238.1

Homo sapiens ST3 beta-galactoside alpha-2,3-sialyltransferase 5 (ST3GAL5), transcript variant 10, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
ST3GAL5 (8869)
Length:
2329
CDS:
146..1318

Additional Resources:

NCBI RefSeq record:
NM_001354238.1
NBCI Gene record:
ST3GAL5 (8869)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354238.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036135 CCCTGAACACTTGAAAGCCAA pLKO.1 610 CDS 100% 2.640 3.696 N ST3GAL5 n/a
2 TRCN0000323262 CATTGAATACAGGTAACTAAT pLKO_005 1646 3UTR 100% 13.200 10.560 N ST3GAL5 n/a
3 TRCN0000036138 CCACTGTCTGACCTTGAATAT pLKO.1 806 CDS 100% 13.200 9.240 N ST3GAL5 n/a
4 TRCN0000301137 CCACTGTCTGACCTTGAATAT pLKO_005 806 CDS 100% 13.200 9.240 N ST3GAL5 n/a
5 TRCN0000036137 GTGGAGGCATTGATCGTGAAT pLKO.1 1293 CDS 100% 4.950 3.465 N ST3GAL5 n/a
6 TRCN0000301057 GTGGAGGCATTGATCGTGAAT pLKO_005 1293 CDS 100% 4.950 3.465 N ST3GAL5 n/a
7 TRCN0000036136 GCTCAGAAATATGCTCAGCAA pLKO.1 383 CDS 100% 2.640 1.848 N ST3GAL5 n/a
8 TRCN0000301138 GCTCAGAAATATGCTCAGCAA pLKO_005 383 CDS 100% 2.640 1.848 N ST3GAL5 n/a
9 TRCN0000036134 GCTGTTATTTGAGCACAGGTA pLKO.1 451 CDS 100% 2.640 1.848 N ST3GAL5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354238.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11315 pDONR223 100% 99.9% 99.7% None 227A>G n/a
2 ccsbBroad304_11315 pLX_304 0% 99.9% 99.7% V5 227A>G n/a
3 TRCN0000471221 CTCTTGCTCCGCTGCCTTCCCTAG pLX_317 38.4% 99.9% 99.7% V5 227A>G n/a
Download CSV