Transcript: Human NM_001354251.2

Homo sapiens family with sequence similarity 160 member B2 (FAM160B2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
FAM160B2 (64760)
Length:
4410
CDS:
373..2430

Additional Resources:

NCBI RefSeq record:
NM_001354251.2
NBCI Gene record:
FAM160B2 (64760)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354251.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263921 CATACGTCCACGATGCTTATG pLKO_005 1880 CDS 100% 10.800 15.120 N FAM160B2 n/a
2 TRCN0000263922 CATCGAGAGCACAGATGAAAG pLKO_005 309 5UTR 100% 10.800 8.640 N FAM160B2 n/a
3 TRCN0000178733 CGTCTGGACTCTTAGATTCAT pLKO.1 3747 3UTR 100% 5.625 4.500 N FAM160B2 n/a
4 TRCN0000263920 AGCCTTGTCTGTGTCACATTA pLKO_005 2851 3UTR 100% 13.200 9.240 N FAM160B2 n/a
5 TRCN0000282859 CCACAGAGAGCAACCTGATTA pLKO_005 917 CDS 100% 13.200 9.240 N FAM160B2 n/a
6 TRCN0000263919 CTAGCTCCTGCTACCAGTTAC pLKO_005 1759 CDS 100% 10.800 7.560 N FAM160B2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354251.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12482 pDONR223 100% 50.3% 50.2% None 1_1020del;1876C>T n/a
2 ccsbBroad304_12482 pLX_304 0% 50.3% 50.2% V5 1_1020del;1876C>T n/a
3 TRCN0000466274 GCACAGGACATCCCGTTACCTTTA pLX_317 34.3% 50.3% 50.2% V5 1_1020del;1876C>T n/a
Download CSV