Transcript: Human NM_001354678.2

Homo sapiens protein kinase C delta (PRKCD), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
PRKCD (5580)
Length:
2610
CDS:
81..2159

Additional Resources:

NCBI RefSeq record:
NM_001354678.2
NBCI Gene record:
PRKCD (5580)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145526 CAGCACCCGCTTCTCAACCA pXPR_003 TGG 1234 59% 12 1.1138 PRKCD PRKCD 76002
2 BRDN0001147061 TGCAGAGCGTGGGAAAACAC pXPR_003 TGG 175 8% 3 0.5064 PRKCD PRKCD 76004
3 BRDN0001147700 ATCTCTCGGGCAGACAACAG pXPR_003 TGG 1037 50% 11 0.1915 PRKCD PRKCD 76003
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354678.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272640 CAACAGCCGGGACACTATATT pLKO_005 767 CDS 100% 15.000 21.000 N PRKCD n/a
2 TRCN0000195408 CAGAGCCTGTTGGGATATATC pLKO.1 1048 CDS 100% 13.200 9.240 N PRKCD n/a
3 TRCN0000272637 CAGAGCCTGTTGGGATATATC pLKO_005 1048 CDS 100% 13.200 9.240 N PRKCD n/a
4 TRCN0000284800 CTTCGGAGGGAAATTGTAAAT pLKO_005 2352 3UTR 100% 13.200 9.240 N PRKCD n/a
5 TRCN0000379731 CATTACTTGAATGTAGTTATC pLKO_005 2382 3UTR 100% 10.800 7.560 N PRKCD n/a
6 TRCN0000195598 CGGCATGAATGTGCACCATAA pLKO.1 920 CDS 100% 10.800 7.560 N PRKCD n/a
7 TRCN0000010203 GCAGGGATTAAAGTGTGAAGA pLKO.1 896 CDS 100% 4.950 3.465 N PRKCD n/a
8 TRCN0000272685 GCAGGGATTAAAGTGTGAAGA pLKO_005 896 CDS 100% 4.950 3.465 N PRKCD n/a
9 TRCN0000196625 GCTGTATATATTGCTCAGTAG pLKO.1 2451 3UTR 100% 4.050 2.835 N PRKCD n/a
10 TRCN0000010194 CAAGGCTACAAATGCAGGCAA pLKO.1 681 CDS 100% 2.640 1.848 N PRKCD n/a
11 TRCN0000010202 GCAAGACAACAGTGGGACCTA pLKO.1 1109 CDS 100% 2.640 1.848 N PRKCD n/a
12 TRCN0000010193 GGCCGCTTTGAACTCTACCGT pLKO.1 1455 CDS 100% 0.250 0.175 N PRKCD n/a
13 TRCN0000272684 GGCCGCTTTGAACTCTACCGT pLKO_005 1455 CDS 100% 0.250 0.175 N PRKCD n/a
14 TRCN0000199551 CCTGGACAGATCAGGCTAGCC pLKO.1 2164 3UTR 100% 0.000 0.000 N PRKCD n/a
15 TRCN0000381180 GGCATGAATGTGCACCATAAA pLKO_005 921 CDS 100% 13.200 7.920 N PRKCD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354678.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489248 TTGAACAGTACCCTATCAGCCCTG pLX_317 19.4% 97.5% 97.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000491986 TAATCCTCAGGCACGGTGTTGGTT pLX_317 18% 97.4% 97.5% V5 (many diffs) n/a
Download CSV