Transcript: Human NM_001354682.2

Homo sapiens zinc finger and BTB domain containing 25 (ZBTB25), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ZBTB25 (7597)
Length:
10822
CDS:
526..1950

Additional Resources:

NCBI RefSeq record:
NM_001354682.2
NBCI Gene record:
ZBTB25 (7597)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354682.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021295 CGCTTGTCACAAGAACACTTA pLKO.1 1864 CDS 100% 4.950 6.930 N ZBTB25 n/a
2 TRCN0000021294 GCCGACTACCTTTCTCACATT pLKO.1 952 CDS 100% 4.950 6.930 N ZBTB25 n/a
3 TRCN0000275885 GCCGACTACCTTTCTCACATT pLKO_005 952 CDS 100% 4.950 6.930 N ZBTB25 n/a
4 TRCN0000021298 CCAACCTGACATATTCAGCTA pLKO.1 846 CDS 100% 2.640 3.696 N ZBTB25 n/a
5 TRCN0000285454 CCAACCTGACATATTCAGCTA pLKO_005 846 CDS 100% 2.640 3.696 N ZBTB25 n/a
6 TRCN0000021296 GCCAGTAGAATTAAACTGTAA pLKO.1 1641 CDS 100% 4.950 3.960 N ZBTB25 n/a
7 TRCN0000021297 GCTTCCATTCTGGAAAGTAAT pLKO.1 1453 CDS 100% 13.200 9.240 N ZBTB25 n/a
8 TRCN0000275884 GCTTCCATTCTGGAAAGTAAT pLKO_005 1453 CDS 100% 13.200 9.240 N ZBTB25 n/a
9 TRCN0000275886 CAGATCAGTCAAGTATCTTTG pLKO_005 1603 CDS 100% 10.800 7.560 N ZBTB25 n/a
10 TRCN0000275946 TTGGAGGAAGGGATTCGATTT pLKO_005 925 CDS 100% 10.800 6.480 N ZBTB25 n/a
11 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 7953 3UTR 100% 4.950 2.475 Y CFLAR n/a
12 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 7953 3UTR 100% 4.950 2.475 Y C19orf31 n/a
13 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 8029 3UTR 100% 4.950 2.475 Y ORAI2 n/a
14 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 7663 3UTR 100% 4.950 2.475 Y ERAP2 n/a
15 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 5080 3UTR 100% 4.950 2.475 Y n/a
16 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 7552 3UTR 100% 13.200 6.600 Y LIAS n/a
17 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2813 3UTR 100% 5.625 2.813 Y KLHL30 n/a
18 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 8026 3UTR 100% 4.950 2.475 Y LOC339059 n/a
19 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 7951 3UTR 100% 4.950 2.475 Y ERN2 n/a
20 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 7951 3UTR 100% 4.950 2.475 Y P3H4 n/a
21 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 7951 3UTR 100% 4.950 2.475 Y P3H4 n/a
22 TRCN0000139610 CGAACTCCTGACCTTGTGATA pLKO.1 6624 3UTR 100% 4.950 2.475 Y RBM48 n/a
23 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2813 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354682.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01803 pDONR223 100% 91.7% 91.7% None 1_117del n/a
2 ccsbBroad304_01803 pLX_304 0% 91.7% 91.7% V5 1_117del n/a
3 TRCN0000481016 CAGCGCAGAGCACTAAGCAGGTTG pLX_317 31.6% 91.7% 91.7% V5 1_117del n/a
Download CSV