Transcript: Human NM_001354703.2

Homo sapiens transferrin (TF), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
TF (7018)
Length:
21134
CDS:
1149..3113

Additional Resources:

NCBI RefSeq record:
NM_001354703.2
NBCI Gene record:
TF (7018)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354703.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373748 GCACTTTCCGTAGACCTTAAA pLKO_005 3094 CDS 100% 13.200 18.480 N TF n/a
2 TRCN0000373747 TACACCAGAGGCAGGGTATTT pLKO_005 2333 CDS 100% 13.200 10.560 N TF n/a
3 TRCN0000047069 GCACTCGACTATATTTGAGAA pLKO.1 1691 CDS 100% 4.950 3.960 N TF n/a
4 TRCN0000373749 ACTACAATAAGAGCGATAATT pLKO_005 2305 CDS 100% 15.000 10.500 N TF n/a
5 TRCN0000047071 CCACGTAAACCTCTTGAGAAA pLKO.1 1497 CDS 100% 4.950 3.465 N TF n/a
6 TRCN0000047072 CCATGGGCTAAGAATCTGAAT pLKO.1 2718 CDS 100% 4.950 3.465 N TF n/a
7 TRCN0000047068 CCTGCTCTACAATAAGATCAA pLKO.1 2468 CDS 100% 4.950 3.465 N TF n/a
8 TRCN0000047070 CCAGTCTCTGTAAGCTGTGTA pLKO.1 2548 CDS 100% 4.950 2.970 N TF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354703.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07048 pDONR223 100% 93.4% 93.1% None (many diffs) n/a
2 ccsbBroad304_07048 pLX_304 0% 93.4% 93.1% V5 (many diffs) n/a
3 TRCN0000481109 CTGGTAAAGACATGTTTGCATAGC pLX_317 18.3% 93.4% 93.1% V5 (many diffs) n/a
Download CSV