Transcript: Human NM_001354802.1

Homo sapiens glucokinase (GCK), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
GCK (2645)
Length:
1610
CDS:
358..588

Additional Resources:

NCBI RefSeq record:
NM_001354802.1
NBCI Gene record:
GCK (2645)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354802.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010267 CGACCGCAAGCAGATCTACAA pLKO.1 246 5UTR 100% 4.950 6.930 N GCK n/a
2 TRCN0000199353 CGAGGACGTAATGCGCATCAC pLKO.1 411 CDS 100% 1.350 1.890 N GCK n/a
3 TRCN0000199354 CGTGGATGGCTCCGTGTACAA pLKO.1 438 CDS 100% 1.650 1.155 N GCK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354802.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00624 pDONR223 100% 16.3% 16.3% None 0_1ins1140;228_229ins27 n/a
2 ccsbBroad304_00624 pLX_304 0% 16.3% 16.3% V5 0_1ins1140;228_229ins27 n/a
3 TRCN0000468306 GCGATAACTTATGCTACTCCATAT pLX_317 31.6% 16.3% 16.3% V5 0_1ins1140;228_229ins27 n/a
4 ccsbBroadEn_14654 pDONR223 0% 16.3% 16.3% None 0_1ins1140;228_229ins27 n/a
5 ccsbBroad304_14654 pLX_304 0% 16.3% 16.3% V5 0_1ins1140;228_229ins27 n/a
6 TRCN0000480104 TCCTATTCACCTTTCACATAAAAC pLX_317 25.5% 16.3% 16.3% V5 0_1ins1140;228_229ins27 n/a
7 TRCN0000489651 ACAGAGTAGCGGTATCCGCCCAAT pLX_317 25.1% 16.3% 16.3% V5 (not translated due to prior stop codon) 0_1ins1140;228_229ins27 n/a
8 TRCN0000489668 TGCTACGCCATCCATTGTTCTGGC pLX_317 24.9% 16.3% 16.3% V5 (not translated due to prior stop codon) 0_1ins1140;228_229ins27 n/a
9 TRCN0000489255 TCACTGTGAAGAAGTACTGAATTT pLX_317 28.6% 16.3% 16.3% V5 0_1ins1140;228_229ins28 n/a
Download CSV